Difference between revisions of "Team:BostonU/Medal Criteria"

Bronze

---

1. Register and attend: Register and Attend the 2016 iGEM Jamboree.

We registered for and attended the 2016 iGEM Jamboree. We also had a phenomenal summer.

2. Deliverables: Meet all the deliverables on the Requirements page.

We completed all of the required deliverables for a standard track team: (1) we designed a wiki, (2) we created a poster, (3) we developed a presentation, (4) we wrote a detailed attribution list, (5) we created new BioBrick Registry part pages, (6) we submitted DNA samples of new parts to the BioBrick Registry, (7) we completed all safety forms, and (8) we completed the Judging Form.

3. Attribution: Create a page on your team wiki with clear attribution of each aspect of your project. This page must clearly attribute work done by the students and distinguish it from work done by other, including host labs, advisors, instructors, sponsors, professional website designers, artists, and commercial services.

We created an attribution list to thank everyone for all of their help and services that aided in the completion of our project. We also want to give credit where credit is due. You can find our full Attribution List here.

4. Part / Contribution: Document at least one new standard BioBrick Part or Device central to your projectand submit this part to the iGEM Registry You may also document a new application of a BioBrick part from a previous iGEM year, adding that documentation to the part main page.

We have documented and submitted BBa_K1875000 and BBa_K1875001, new standard BioBrick Composite Parts that are central to our project, to the iGEM Registry. These two parts are designed to produce guides that pair with specific operator sites to create Gemini’s functional systems. Specifically, they correspond to g3 (AATGAACCTATTCGTACCGT) and g8 (GTTGCGCGTCCGTATCAAGG) respectively. When in the presence of CRISPR/dCas9-VPR, BBa_K1875000 pairs with BBa_K1875003, a guide operator, to express GFP. When BBa_K1875001 is co-transfected with CRISPR/dCas9-VPR it pairs with BBa_K1875004, a different guide operator, to produce GFP as well. You can read about all of our contributions to the BioBrick Registry on our Parts page.

Silver

1. Validated Part / Validated Contribution: Experimentally validate that at least one new BioBrick Part of Device of your own design and construction works as expected. Document this characterization of this part in the Main Page section of that Part's/Device's Registry entry. Submit this new part to the iGEM Parts Registry. This working part must be different from the part documented in bronze medal criterion #4.

We have validated that our new standard BioBrick Composite Parts, BBa_K1875002, BBa_K1875003, BBa_K1875004, BBa_K1875005, BBa_K1875006, and BBa_K1875007, work as expected. Parts BBa_K1875002 through BBa_K1875005 are all guide RNA operator reporter vectors with a single binding site for dCas9-VPR. All of these vectors have a GFP reporter gene downstream of a miniCMV promoter. These plasmids were tested for both their capacity for activating gene expression as well as mutual orthogonality. BBa_K1875006 and BBa_K1875007 express the same reporter gene as the previous four parts and function under the same promoter; however, these parts have two and three binding sites spaced 24 bases apart for dCas9-VPR to attach to respectively. These two constructs represent the highest expressing double and triple multimerized constructs from a multimerization screen.

2. Collaboration: Convince the judges you have helped any registered iGEM team from high school, a different track, another university or another institution in a significant way by, for example, mentoring a new team, characterizing a part,, debugging a construct, modeling/simulating their system or helping validate a software/hardware solution to a synbio problem.

We collaborated with two iGEM teams this season: (1) Team WPI and (2) Team BostonU_HW.

1) We set up an experimental methods collaboration with Team WPI. At the first New England iGEM Meetup in June, WPI discussed their project using CRISPR to perform point mutations in RNA. They planned to qualitatively measure fluorescence using a microscope because it was what they had access to. We realized that they could benefit from using a flow cytometer as a quantitative method and offered them access to our institution’s own flow cytometers. They accepted our invitation and visited our lab. We helped them run their cells through our Fortessa flow cytometer and collect and analyze the data. Together we set out to quantify their mutant ACG GFP and their wild type GFP function’s in comparison to an eGFP. They also used our flow cytometer to compare the results of their microscope image analyzer. To thank us, they offered to help us analyze the fluorescence of our constructs using their microscope for additional validation.

2) We set up a Human Practices collaboration with our sister team, BostonU_HW (hardware special track team). Both of our teams were interested in understanding and engaging fellow researchers in intellectual property paradigms in synthetic biology . Our teams created a new blog called “Who Owns What” and co-wrote several blog posts to share with the wider synthetic biology community.

For more information look at our Collaborations page.

3. Human Practices: iGEM projects involve important questions beyond the lab bench, for example relating to (but not limited to) ethics, sustainability, social justice, safety, security, and intellectual property rights. Demonstrate how your team has identified, investigated, and addresed one or more of these issues in the context of your project. Your activity could center around education, public engagement, public policy issues, public perception, or other activities.

We completed several distinct Human Practices projects.

One major topic that we investigated was about intellectual property in synthetic biology. Our team attended the Mammalian Synthetic Biology Workshop in June, which concluded with a panel about intellectual property (IP). We were surprised that this module had perhaps twenty percent attendance as other modules in the workshop. When discussing the importance of IP with our mentors - PIs and graduate students - we discovered that there was not much knowledge about the topic, perhaps due to lack of interest and/or accessibility. We teamed up with Team BostonU_HW to create a light-hearted blog called “Who Owns What: A mildly entertaining look into intellectual property in synthetic biology.” We shared our blog with Boston University and the wider iGEM community, and hope that our entertaining discussions on IP clarified key concepts and demonstrated the importance of these topic.

We also participated in the the Boston Museum of Science’s “Building with Biology” series. We led interactive synthetic biology activities for all museum-goers including isolating DNA from wheat germ and simulating the viral engineering process.We were also able to present a simple toy model of our iGEM project. We also participated in a forum discussion on engineering mosquitoes using gene drives with members of the public. We were really inspired by the forum activity as an innovative way of engaging the public in bioethics discussions and developed a new set of forums for the community (see Gold: Integrated Human Practices).

Gold

1. Integrated Human Practices: Expand on your silver medal activity by demonstrating how you have integrated the investigated issues into the design and/or execution of your project.

Inspired by a forum held after the Museum of Science’s Building with Biology event, we decided to create ethical forums for high school students that focused on foundational advancements in synthetic biology, ranging from Martian Colonization to Genetically Engineering the Mosquito. These forums provided background about the topic to be discussed, several plans of action, considerations to keep in mind when drawing to a conclusion, and questions to aid students to come to a solution. We contacted several high schools and had the pleasure of conducting them for a high school class, a summer high school STEM program, and a college course. We are also planning to host a mini Jamboree for high school students that will include one of our forums that is set to take place in February 2017. You can read about our visits and our forums here.

2. Improve a previous part or project: Improve the function OR characerization of an existing BioBrick Part or Device and enter this information in the Registry. The part must NOT be from your 2016 part number range.

Our guide operators contain a minimal CMV promoter, we thought that we it would be best to improve the characterization of a full CMV that has already been submitted to the iGEM BioBrick Registry (BBa_I712004). We PCRed around the CMV and gel extracted it. We then ligated and it into one of our operator-promoter backbones containing GFP. We then transformed E. coli and transfected the plasmids into HEK 293FT cells. We tested how single activated operators, as well as a triple multimerized operator, both containing a minimal CMV, compared to the BioBrick Registry’s CMV through flow cytometry. We found that while the single operator expressed less than the Registry’s CMV, our triple multimerized operators had greater fluorescence expression than the Registry’s CMV. You can view our data on our Parts page.

3. Proof of Concept:Demonstrate a functional proof of concept of your project. Your proof of concept must consist of a BioBrick device; a single BioBrick part cannot constitute a proof of concept.

When we set out to develop Gemini, we had three distinct goals: develop a collection of mutually orthogonal “digital” parts, developing a collection of “analog” parts, and integrating the parts from the library into genetic circuit context. In the initial stages of our project, we screened over one thousand guides against hg19 using MIT’s CRISPR optimization tool. From there we selected 20 guides for synthesis and screened them in iRFP for activation ability. We then selected four guides and tested their mutual orthogonality. Finally, we cloned the guides into three additional genes of interest (GFP, BFP, mRuby). The results for this can be found on (INSERT Appropriate Link). We then moved to expand our library into analog expression by multimerizing the binding sites (to increase expression) and mutating the binding sites (to decrease expression). The results of these screens can be found on (Insert Appropriate Link). It can be seen that these techniques to alter the expression levels of our operators. Finally, we integrated our parts into increasingly complex genetic circuits which can be found out (insert link here). The results prove that our system can be used to in gene logic and can handle increasingly complex computation. See our Project Tab to see the progression of our work, or go to the Proof of Concept to find an abridge collection of results.