Difference between revisions of "Team:BostonU/Medal Criteria"

Bronze

---

1. Register and attend: Register and Attend the 2016 iGEM Jamboree.

We registered for and attended the 2016 iGEM Jamboree. We also had a phenomenal summer!

2. Deliverables: Meet all the deliverables on the Requirements page.

We completed all of the required deliverables for a standard track team: (1) we designed a wiki, (2) we created a poster, (3) we developed a presentation, (4) we wrote a detailed attribution list, (5) we created new BioBrick Registry part pages, (6) we submitted DNA samples of new parts to the BioBrick Registry, (7) we completed all safety forms, and (8) we completed the Judging Form.

3. Attribution: Create a page on your team wiki with clear attribution of each aspect of your project. This page must clearly attribute work done by the students and distinguish it from work done by other, including host labs, advisors, instructors, sponsors, professional website designers, artists, and commercial services.

We created an attribution list to thank everyone for all of their help and services that aided in the completion of our project. We also want to give credit where credit is due. You can find our full Attribution List here.

4. Part / Contribution: Document at least one new standard BioBrick Part or Device central to your projectand submit this part to the iGEM Registry You may also document a new application of a BioBrick part from a previous iGEM year, adding that documentation to the part main page.

We have documented and submitted BBa_K1875011 and BBa_K1875012, new standard BioBrick Composite Parts that are central to our project, to the iGEM Registry. These two parts are designed to produce guides that pair with specific operator sites to create Gemini’s functional systems. Specifically, they correspond to g3 (AATGAACCTATTCGTACCGT) and g8 (GTTGCGCGTCCGTATCAAGG) respectively. When in the presence of CRISPR/dCas9-VPR, BBa_K1875011 pairs with BBa_K1875014, a guide operator, to express GFP. When BBa_K1875012 is co-transfected with CRISPR/dCas9-VPR it pairs with BBa_K1875015, a different guide operator, to produce GFP as well. You can read about all of our contributions to the BioBrick Registry on our Parts page.

Silver

1. Validated Part / Validated Contribution: Experimentally validate that at least one new BioBrick Part of Device of your own design and construction works as expected. Document this characterization of this part in the Main Page section of that Part's/Device's Registry entry. Submit this new part to the iGEM Parts Registry. This working part must be different from the part documented in bronze medal criterion #4.

We have validated that our new standard BioBrick Composite Parts BBa_K1875013, BBa_K1875014, BBa_K1875015, BBa_K1875016, BBa_K1875017, BBa_K1875018, and BBa_K1875019 work as expected. Parts BBa_K1875013 through BBa_K1875016 are all guide RNA operator reporter vectors with a single binding site for dCas9-VPR. All of these vectors have a GFP reporter gene downstream of a miniCMV promoter. These plasmids were tested for both their capacity for activating gene expression as well as mutual orthogonality. BBa_K1875017 and BBa_K1875018 express the same reporter gene as the previous four parts and function under the same promoter; however, these parts have two and three binding sites spaced 24 bases apart for dCas9-VPR to attach to respectively. These two constructs represent the highest expressing double and triple multimerized constructs from a multimerization screen. BBa_K18750019 is a mutated form of BBa_K1875016, with the 10th base of the guide target sequence being shifted from a guanine to a thymine, reducing expression.

2. Collaboration: Convince the judges you have helped any registered iGEM team from high school, a different track, another university or another institution in a significant way by, for example, mentoring a new team, characterizing a part, debugging a construct, modeling/simulating their system or helping validate a software/hardware solution to a synbio problem.

We collaborated with two iGEM teams this season: (1) Team WPI and (2) Team BostonU_HW.

1) We set up an experimental methods collaboration with Team WPI. At the first New England iGEM Meetup in June, WPI discussed their project using CRISPR to perform point mutations in RNA. They planned to qualitatively measure fluorescence using a microscope because it was what they had access to. We realized that they could benefit from using a flow cytometer as a quantitative method and offered them access to our institution’s own flow cytometers. They accepted our invitation and visited our lab. We helped them run their cells through our Fortessa flow cytometer and collect and analyze the data. Together we set out to quantify their mutant ACG GFP and their wild type GFP function’s in comparison to an eGFP. They also used our flow cytometer to compare the results of their microscope image analyzer. To thank us, they offered to help us analyze the fluorescence of our constructs using their microscope for additional validation. The results of this can be seen on our Proof of Concept Page. The microscopy results corroborated out flow cytometry data.

2) We set up a Human Practices collaboration with our sister team, BostonU_HW (hardware special track team). Both of our teams were interested in understanding and engaging fellow researchers in intellectual property paradigms in synthetic biology . Our teams created a new blog called “Who Owns What” and co-wrote several blog posts to share with the wider synthetic biology community.

For more information look at our Collaborations page.

3. Human Practices: iGEM projects involve important questions beyond the lab bench, for example relating to (but not limited to) ethics, sustainability, social justice, safety, security, and intellectual property rights. Demonstrate how your team has identified, investigated, and addressed one or more of these issues in the context of your project. Your activity could center around education, public engagement, public policy issues, public perception, or other activities.

We completed several distinct Human Practices projects.

One major topic that we investigated was about intellectual property in synthetic biology. Our team attended the Mammalian Synthetic Biology Workshop in June, which concluded with a panel about intellectual property (IP). We were surprised that this module had perhaps twenty percent attendance as other modules in the workshop. When discussing the importance of IP with our mentors - PIs and graduate students - we discovered that there was not much knowledge about the topic, perhaps due to lack of interest and/or accessibility. We teamed up with Team BostonU_HW to create a light-hearted blog called “Who Owns What: A mildly entertaining look into intellectual property in synthetic biology.” We shared our blog with Boston University and the wider iGEM community, and hope that our entertaining discussions on IP clarified key concepts and demonstrated the importance of these topic.

We also participated in the the Boston Museum of Science’s “Building with Biology” series. We led interactive synthetic biology activities for all museum-goers including isolating DNA from wheat germ and simulating the viral engineering process.We were also able to present a simple toy model of our iGEM project. We also participated in a forum discussion on engineering mosquitoes using gene drives with members of the public. We were really inspired by the forum activity as an innovative way of engaging the public in bioethics discussions and developed a new set of forums for the community (see Gold: Integrated Human Practices).

Gold

1. Integrated Human Practices: Expand on your silver medal activity by demonstrating how you have integrated the investigated issues into the design and/or execution of your project.

Inspired by a forum that we participated in at the Museum of Science’s “Building with Biology” event, we decided to develop new bioethics forums for high school students focusing on significant applications of foundational advancements in synthetic biology.

We began development of 4 new forums: (1) Martian Colonization, (2) Genetically Engineered Mosquitoes, (3) Genetically Modified Foods, and (4) Editing the Human Germline. These forums provide relevant background about the topic and science, several plans of action, considerations to keep in mind when drawing a conclusion, and questions to aid students to come to a solution.

This summer we had the pleasure of leading forums for a summer high school STEM program and a molecular bioengineering undergraduate course at BU. We have shared these forums with the wider community on our wiki, and will also be leading these at a high school class in a few weeks, and at a “mini-Jamboree” event for high school students and undergraduates in February 2017. You can read about our visits and our forums on our Bioethics Forums page.

Through our forums and discussions, we realized that while our project is foundational and far from immediate downstream applications, it could still generate very opinionated discussions among individuals with diverse viewpoints. This forced us to look critically at our own research and evaluate directions of our experiments and design. Specifically, we decided to synthetically regulate expression of exogenous genes, and avoided attempting to target or regulate any endogenous genes. We also considered potential off-target capabilities of our system and public fears of unintended interactions, and intentionally selected gRNAs with the lowest chance of undesired genomic interactions.

2. Improve a previous part or project: Improve the function OR characerization of an existing BioBrick Part or Device and enter this information in the Registry. The part must NOT be from your 2016 part number range.

We decided to improve characterization of a full length CMV promoter, BBa_I712004, from Team Heidelberg 2009’s submitted parts. This part is one of the only available mammalian promoters in the BioBrick Registry, and was only tested thus far in HeLa cells.

We cloned the part upstream of a GFP gene in one of our mammalian expression backbones, and transiently transfected the device into HEK293FT cells. We also compared the expression of GFP under this constitutive promoter to several of our engineered minimal CMV “guide RNA-inducible” promoters. We quantitatively measured GFP expression using flow cytometry.

We saw that the pCMV device successfully expressed GFP in HEK293FT cells, and included this characterization data on the registry page. We also noted that our 1X gRNA operator devices expressed GFP at a level lower than the pCMV, while one of our 3X gRNA operator devices expressed GFP to a higher level. This result also improves characterization by providing the relative strength of the full CMV promoter compared to our new library of operator parts containing a minimal CMV promoter.

You can view our data on our Improved Part Characterization Page.

3. Proof of Concept:Demonstrate a functional proof of concept of your project. Your proof of concept must consist of a BioBrick device; a single BioBrick part cannot constitute a proof of concept.

Our system, Gemini, was developed to combine digital and analog expression systems as method to develop a foundational platform to handle increasingly complex applications. As a proof of concept, we demonstrated that we could achieve both “digital” and “analog” expression patterns using standardized biological parts.

In addition to a dCas9- VPR supplied by our lab, we created a collection of parts that could achieve “digital” expression. These involved a set of genome-orthogonal and mutually-orthogonal guide RNAs, and 1X gRNA-operator minimal reporters. We demonstrated that at least 4 of these expression pairs functioned as expected, with minimal basal expression (-gRNA) and high activated expression (+gRNA). We also proved that these can regulate expression of different genes by testing gene activation in four different fluorescent proteins. The results from this work can be found here under digtial. We prove that we could develop a digital library.

We then created a collection of parts that could extend the “digital” expression to achieve “analog” expression. We paired our set of gRNAs and multimerized or mutated the gRNA-operator minimal reporters to respectively increase or decrease relative expression. We demonstrated that at least 14 of these expression pairs functioned as expected, offering a range of intermediate expression levels. The results from this work can be found here under analog. We prove we could expand expression of our digital library.

Finally, we integrated our digital and analog expression parts into genetic circuits to demonstrate conditional digital and analog expression. Specifically, we used established recombinase-based circuits, the backbone of which was provided by our lab, and inserted the gRNA expression vectors between recombination sites to conditionally express different gRNAs. These gRNAs would then bind to their paired operators and could subsequently turn gene activity to specified levels, using different reporters from our digital and analog construct repositories.

For digital outputs, we developed several types of circuits. These include an AND gate, a NOR gate, an XNOR gate, as well as an array of Line Decoder. The data from these experiments can be found here under circuits. With these circuit we proved that our Gemini Library can be used to produce a variety of digital behaviors.

For analog outputs, we attempted an experiment in which by altering the logical state of our circuit, it would result in a change in the expression of GFP with some degree of predictability. The results of this experiment can be seen here under circuits. We prove that we can, relatively, predictable develop analog responses with our Library.