Difference between revisions of "Team:XMU-China/Proof"

(<script type="text/javascript" src="https://2016.igem.org/Template:XMU-China/mathjax/latest/MathJax.js?action=raw&ctype=text/javascript"></script>)
 
(88 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
<html>
 
<html>
 
<head>
 
<head>
 +
<link rel="apple-touch-icon" sizes="57x57"
 +
                  href="https://static.igem.org/mediawiki/2016/9/9d/T--XMU-China--icon-57x57_and_.png">
 +
            <link rel="apple-touch-icon" sizes="60x60"
 +
                  href="https://static.igem.org/mediawiki/2016/d/de/T--XMU-China--icon-60x60_and_.png">
 +
            <link rel="apple-touch-icon" sizes="72x72"
 +
                  href="https://static.igem.org/mediawiki/2016/a/a8/T--XMU-China--icon-72x72_and_.png">
 +
            <link rel="apple-touch-icon" sizes="76x76"
 +
                  href="https://static.igem.org/mediawiki/2016/2/22/T--XMU-China--icon-76x76_and_.png">
 +
            <link rel="apple-touch-icon" sizes="114x114"
 +
                  href="https://static.igem.org/mediawiki/2016/3/30/T--XMU-China--icon-144x144_and_.png">
 +
            <link rel="apple-touch-icon" sizes="120x120"
 +
                  href="https://static.igem.org/mediawiki/2016/7/79/T--XMU-China--icon-120x120_and_.png">
 +
            <link rel="apple-touch-icon" sizes="144x144"
 +
                  href="https://static.igem.org/mediawiki/2016/3/30/T--XMU-China--icon-144x144_and_.png">
 +
            <link rel="apple-touch-icon" sizes="152x152"
 +
                  href="https://static.igem.org/mediawiki/2016/c/c5/T--XMU-China--icon-152x152_and_.png">
 +
            <link rel="apple-touch-icon" sizes="180x180"
 +
                  href="https://static.igem.org/mediawiki/2016/7/7c/T--XMU-China--icon-180x180_and_.png">
 +
            <link rel="icon" type="image/png" sizes="192x192"
 +
                  href="https://static.igem.org/mediawiki/2016/b/bd/T--XMU-China--icon-192x192_and_.png">
 +
            <link rel="icon" type="image/png" sizes="32x32"
 +
                  href="https://static.igem.org/mediawiki/2016/4/46/T--XMU-China--icon-32x32_and_.png">
 +
            <link rel="icon" type="image/png"  sizes="96x96"
 +
                  href="https://static.igem.org/mediawiki/2016/1/1e/T--XMU-China--icon-96x96_and_.png">
 +
            <link rel="icon" type="image/png" sizes="16x16"
 +
                  href="https://static.igem.org/mediawiki/2016/6/6c/T--XMU-China--icon-16x16_and_.png">
 +
            <meta name="msapplication-TileImage"
 +
                  content="https://static.igem.org/mediawiki/2016/9/98/T--XMU-China--icon-114x114_and_.png">
 +
            <meta name="msapplication-TileColor" content="#ffffff">
 +
            <meta name="theme-color" content="#ffffff">
 
<meta charset="utf-8">
 
<meta charset="utf-8">
 
     <meta http-equiv="X-UA-Compatible" content="IE=edge">
 
     <meta http-equiv="X-UA-Compatible" content="IE=edge">
 
     <meta name="viewport" content="width=device-width, initial-scale=1">
 
     <meta name="viewport" content="width=device-width, initial-scale=1">
 
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
 
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<script type="text/x-mathjax-config">
+
<script type="text/javascript" src="https://2016.igem.org/Template:XMU-China/mathjax/latest/MathJax.js?action=raw&ctype=text/javascript"></script>
MathJax.Hub.Config({
+
  tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}
+
});
+
</script>
+
 
<script type="text/javascript" async
 
<script type="text/javascript" async
   src="https://2016.igem.org/Template:XMU-China/mathjax/latest/MathJax.js?config=TeX-MML-AM_CHTML">
+
   src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-MML-AM_CHTML">
 
</script>
 
</script>
 +
<script type="text/javascript" src="https://2016.igem.org/Template:XMU-China/Javascript/InterlabJs?action=raw&amp;ctype=text/javascript">
 
<script type="text/javascript" src="https://2016.igem.org/Template:XMU-China/css/jQueryJs?action=raw&amp;ctype=text/javascript"></script>
 
<script type="text/javascript" src="https://2016.igem.org/Template:XMU-China/css/jQueryJs?action=raw&amp;ctype=text/javascript"></script>
       <script src="https://oss.maxcdn.com/html5shiv/3.7.3/html5shiv.min.js"></script>
+
       <script src="https://2016.igem.org/XMU-China/html5shiv/3_7_3?action=raw&amp;ctype=text/javascript"></script>
       <script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script>  
+
       <script src="https://2016.igem.org/XMU-China/respond/1_4_2/?action=raw&amp;ctype=text/javascript"></script>
 
<script src="https://2016.igem.org/Template:XMU-China/css/BootstrapJs?action=raw&amp;ctype=text/javascript"></script>
 
<script src="https://2016.igem.org/Template:XMU-China/css/BootstrapJs?action=raw&amp;ctype=text/javascript"></script>
 
<link rel="stylesheet" href="https://2016.igem.org/Template:XMU-China/css/clearCss?action=raw&amp;ctype=text/css" type="text/css">
 
<link rel="stylesheet" href="https://2016.igem.org/Template:XMU-China/css/clearCss?action=raw&amp;ctype=text/css" type="text/css">
Line 27: Line 54:
 
       font-weight:500;
 
       font-weight:500;
 
       padding-bottom:0;
 
       padding-bottom:0;
   
 
 
}
 
}
 
</style>
 
</style>
Line 34: Line 60:
 
<style type="text/css">
 
<style type="text/css">
 
#btn{
 
#btn{
width:110px; height:110px;position:fixed;left:50%;
+
width:90px; height:90px;position:fixed;right:0.1%;
margin-left:42.5%;bottom:30px;background:url(https://static.igem.org/mediawiki/2016/b/ba/T--XMU-China--lightbulb_and_.png);no-repeat left top;display:none;
+
bottom:30px;background:url(https://static.igem.org/mediawiki/2016/b/ba/T--XMU-China--lightbulb_and_.png);no-repeat left top;display:none;
 
border:currenColor;
 
border:currenColor;
 
}
 
}
 
#btn:hover{
 
#btn:hover{
     background:url(https://static.igem.org/mediawiki/2016/b/ba/T--XMU-China--lightbulb_and_.png) no-repeat left -110px;
+
     background:url(https://static.igem.org/mediawiki/2016/b/ba/T--XMU-China--lightbulb_and_.png) no-repeat left -90px;
 
}
 
}
 
.nav>li>a{
 
.nav>li>a{
Line 79: Line 105:
 
<body  data-spy="scroll" data-target="#myScrollspy">
 
<body  data-spy="scroll" data-target="#myScrollspy">
 
<!--heading-->  
 
<!--heading-->  
 
 
<div class="jumbotron" style="background-image:url(https://static.igem.org/mediawiki/2016/8/8d/T--XMU-China--Proof_and_.png);">
 
<div class="jumbotron" style="background-image:url(https://static.igem.org/mediawiki/2016/8/8d/T--XMU-China--Proof_and_.png);">
 
<div class="jumbotron-text">
 
<div class="jumbotron-text">
 
<h1 style="margin-bottom: 0px;padding-bottom:0;border-bottom: 1px solid #333;
 
<h1 style="margin-bottom: 0px;padding-bottom:0;border-bottom: 1px solid #333;
  padding-left:16px; color:#333; font-family:"Times New Roman", Times, serif;overflow:visible; ">Proof of Concept</h1>
+
  padding-left:16px; color:#333; font-family:"Times New Roman", Times, serif;overflow:visible; ">Proof Of Concept</h1>
 
<p style="padding-left:16px; padding-bottom: 15px;
 
<p style="padding-left:16px; padding-bottom: 15px;
 
     font-size: 21px;
 
     font-size: 21px;
     font-weight: 200;color:#333;text-shadow: 0 0 1px black;" id="section-1">Appropriate attribution is half of success.</p>
+
     font-weight: 200;color:#333;text-shadow: 0 0 1px black;" id="section-1">Verities never lie.</p>
 
</div>
 
</div>
 
</div>
 
</div>
 
 
<!--end heading-->
 
<!--end heading-->
  
 
<!--navbar-->
 
<!--navbar-->
 
 
 
<div class="container">
 
<div class="container">
<nav class="navbar  navbar-inverse navbar-fixed-top" style="text-align:center;">
+
<nav class="navbar  navbar-inverse navbar-fixed-top">
 
   <div class="container-fluid">
 
   <div class="container-fluid">
 
     <!-- Brand and toggle get grouped for better mobile display -->
 
     <!-- Brand and toggle get grouped for better mobile display -->
Line 118: Line 140:
 
           <li><a href=" https://2016.igem.org/Team:XMU-China/Description">Description</a></li>
 
           <li><a href=" https://2016.igem.org/Team:XMU-China/Description">Description</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Design">Design</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Design">Design</a></li>
         <li><a href="https://2016.igem.org/Team:XMU-China/Proof">Proof of concept</a></li>
+
         <li><a href="https://2016.igem.org/Team:XMU-China/Proof">Proof Of concept</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Demonstrate">Demonstrate</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Demonstrate">Demonstrate</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Results">Results</a></li>
 
         <li><a href="https://2016.igem.org/Team:XMU-China/Results">Results</a></li>
 
         </ul>
 
         </ul>
       
 
       
 
 
          
 
          
 
           <li class="dropdown" id="Parts">
 
           <li class="dropdown" id="Parts">
Line 179: Line 199:
 
           <div id="sidebar1">
 
           <div id="sidebar1">
 
             <ul class="nav nav-tabs nav-stacked" data-spy="affix" data-offset-top="300">
 
             <ul class="nav nav-tabs nav-stacked" data-spy="affix" data-offset-top="300">
                 <li id="sidehead">Proof of Concept</li>
+
                 <li id="sidehead">Proof Of Concept</li>
                 <li class="active"><a href="#section-1" >Experiment</a></li>
+
                 <li class="active"><a href="#section-1" >Entire circuits test</a></li>
                <li><a href="#section-2" >Result</a></li>
+
 
                 <li><a href="#section-3">Responder test</a></li>
 
                 <li><a href="#section-3">Responder test</a></li>
 
                 <li><a href="#section-4">Model</a></li>  
 
                 <li><a href="#section-4">Model</a></li>  
                 <li><a href="#section-5">Reference</a></li>  
+
                 <li><a href="#section-5">Discussion</a></li>  
             
+
                <li><a href="#section-6">Reference</a></li>             
 
             </ul>
 
             </ul>
 
             </div>
 
             </div>
Line 193: Line 212:
 
               <ul style="color:#000;list-style:none;list-decoration:none;margin-left:3.4%;">
 
               <ul style="color:#000;list-style:none;list-decoration:none;margin-left:3.4%;">
 
                   <li style="font-size:20px;color:#8968CD;border-bottom: 0.5px solid #aaa;width:95%;">Proof Of Concept</li>
 
                   <li style="font-size:20px;color:#8968CD;border-bottom: 0.5px solid #aaa;width:95%;">Proof Of Concept</li>
                 <li ><a style="color:#aaa;" href="#section-1" >Experiment</a></li>
+
                 <li ><a style="color:#aaa;" href="#section-1" >Entire circuits test</a></li>
                <li><a style="color:#aaa;" href="#section-2" >Result</a></li>
+
 
                 <li><a style="color:#aaa;" href="#section-3">Responder test</a></li>
 
                 <li><a style="color:#aaa;" href="#section-3">Responder test</a></li>
 
                 <li><a style="color:#aaa;" href="#section-4">Model</a></li>
 
                 <li><a style="color:#aaa;" href="#section-4">Model</a></li>
                 <li><a style="color:#aaa;" href="#section-5">Reference</a></li>
+
                 <li><a style="color:#aaa;" href="#section-5">Discussion</a></li>
 +
                <li><a style="color:#aaa;" href="#section-6">Reference</a></li>
 
             </ul>
 
             </ul>
                            </div>
+
              </div>          
                       
+
 
                         <!--End sidebar-->
 
                         <!--End sidebar-->
  
 
<!--content-->
 
<!--content-->
  <div class="col-md-10" >
+
  <div class="col-md-10" style="overflow:hidden;">
 
+
 
<h1 id="section-1"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
 
<h1 id="section-1"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
     padding-bottom: -5%;">Experiment
+
     padding-bottom: -5%;">Entire circuits test
 
</h1>
 
</h1>
<h3>Entire ciruct test</h3>
 
 
<center><img src="https://static.igem.org/mediawiki/2016/5/5b/T--XMU-China--result_CG_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 
<center><img src="https://static.igem.org/mediawiki/2016/5/5b/T--XMU-China--result_CG_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
<p>In our experiment, for testing our circuit more conveniently, we use the <em>cfp</em> gene and <em>gfp</em> gene to replace the responder and lysis respectly when constructing our gene circuit. Because the fluorescence is easier to be measured. Also, the strength of the fluorescence can stand for the strength of the corresponding genes' expression.</p>
+
<p>In our experiment, for testing our circuit more conveniently, we use <i>CFP</i> to replace the responder and use <i>GFP</i> to replace lysis. Because the fluorescence intensity is easier to be measured. Also, the intensity of the fluorescence can stand for the intensity of the corresponding genes' expression.</p>
  
<p>When AHL around the engineered bacteria is at low concentration, AHL can't be sensed by the Lux sensor part, and the <em>cI</em> gene is expressed at the wild-type levels. While lacI-2 and YFP are repressed since the CI protein is high. When AHL around the engineered bacteria reach a certain concentration, AHL can be sensed by the sensor part,. So the promoter LuxpR is activated, CFP and lacI-1 are expressed. So the CFP protein can be tested by fluorescence measurement. And the lacI-1' product-LacR protein can inhibit the expression of <em>cI</em> gene. As a result, lacI-2 and GFP can express. The LacI-2' product can further repress <em>cI</em> gene' expression, and GFP protein will be measured by fluorescene detection to represent the lysis gene's expression. The time interval of firstly detecting CFP' fluorescence and firstly detecting GFP' fluorescence can represent the delay time which the switch give for responder' expression.</p>
+
<p>When the concentration of AHL is at low concentration, AHL cannot be detected by the quorum sensing system. And as a consequence, there is no enough inhibitor lacI to repress promoter P<sub>lac</sub>. So the <em>cI</em> gene is expressing at the wild-type levels. While lacI-2 and GFP are repressed since the CI protein is at high concentration. When AHL around the engineered bacteria reached a certain concentration or a threshold value, AHL could be detected by the sensing molecules Lux R. Then, Lux R interacted with AHL and form activating molecules to activate promoter Lux pR. CFP and lacI-1 express, and CFP protein could be detected by fluorescence measurement. And the lacI-1's product-lacR protein could inhibit the expression of <em>cI</em> gene. As a result, lacI-2 and GFP expressed. The lacI-2's product could further repress <em>cI</em> gene's expression, which was a negative feedback system. GFP could be measured by fluorescence detection to represent the level of lysis gene's expression. The time of initial expression of <span id="section-2">CFP</span> and GFP were different. As a result, the interval of time could represent the delay time which the switch give for responder expression.</p>
  
<h1 id="section-2"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
+
<h3>1. AHL Gradient Induction</h3>
    padding-bottom: -5%;">Result
+
<p>As we can see, quorum sensing system could be induced by AHL. As for our gene circuits, when AHL raised to its threshold value and was detected by the sensor part, the promoter Lux PR can be activated, CFP and GFP are expressed. In order to find out the relationship, we decided to make an AHL gradient induction for our gene circuits. </p>
</h1>
+
<p>During our experiment, we first constructed our gene circuit successfully, then we transformed the plasmids into chemical competent cell (DH5&alpha;). And then our engineering bacteria were divided into four groups: experimental group 1, 10 and 20 (c(AHL) = 1 ng/&mu;L, 10 ng/&mu;L, and 20 ng/&mu;L) and blank control group. Then we measured OD600 of the <i>E.coli</i> and the fluorescence intensity of CFP and GFP for 900 minutes. The OD600 showed the growth trend of the engineering bacteria. And the fluorescence intensity of each group showed the relationship between AHL and the expression of our circuits. </p>
<p>From the Last September to October, nearly one year of learning and working, we made so many of mistakes in lab work but eventually obtained ideal data and results. From the results we had, we made following analysis of our system.</p>
+
  
<h3>1. The expression of our gene circuits</h3>
+
<figure><center><img src="https://static.igem.org/mediawiki/2016/7/7e/T--XMU-China--result_fig1_1_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 +
<figcaption><center><strong>Figure 1.1</strong> The OD600 of versus time of experimental group 1, 10, 20 and control</center></figcaption></figure><br/>
 +
<p>From figure 1.1, we found that the growth curves of each group don't show much difference. It suggested that they had the same growth trend, so the difference of fluorescence intensity was mainly from the expression of circuits or other factors.</p>
  
<p>The expression of our gene circuits could be induced by AHL. When AHL is sensed by the sensor part, the promoter LuxpR is activated, CFP and lacI-1 are expressed.</p>
+
<figure><center><img src="https://static.igem.org/mediawiki/2016/f/fa/T--XMU-China--result_fig1_2_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
<p>The <em>E. coli</em> containing our gene circuits were divided into experimental group and blank control group. We added AHL into experimental group and measured OD-600 of the <em>E. coli</em> and the fluorescence intensity of CFP and GFP for 900 minutes. The OD-600 showed the growth trend of the <em>E. coli</em>. The fluorescence intensity data and time showed the relationship of the expression of CFP and GFP to time.</p>
+
<figcaption><center><strong>Figure 1.2</strong>The average cyan fluorescence intensity versus time of experimental group 1, 10, 20 and control.</center> </figcaption>
 
+
</figure><br/>
<center><img src="https://static.igem.org/mediawiki/2016/7/7e/T--XMU-China--result_fig1_1_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
+
<p>So we did experiments at the same condition except the concentration of AHL. As showed in figure 1.2, with the increase of the AHL, the expression of the CFP showed an upper trend. In addition, by means of independent t-test, we compared the fluorescence intensity between the group 1, 10, 20 and control. We found the initial expression time of CFP was different. For group 10 and 20, CFP expressed initially and could be detected in the 240th minute. However, for group 1, CFP started to express in the 480th minute.</p>
<p><center><strong>Figure 1.1</strong> The OD-600 of <em>E. coli</em> and its variety with time on the AHL of 20ng/&mu;L and 0ng/&mu;L.</center></p>
+
<p>The growth curves were similar. It was suggested that they had the same growth trend and the difference of fluorescence intensity was mainly from the expression of circuits.</p>
+
 
+
<center><img src="https://static.igem.org/mediawiki/2016/f/fa/T--XMU-China--result_fig1_2_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
+
<p><center><strong>Figure 1.2</strong> The mean CFP and GFP intensity in <em>E. coli</em> and its variety with time on the AHL of 20ng/&mu;L and 0ng/&mu;L.</center></p>
+
 
+
<p>The experimental group and control group all were significantly different. The fluorescence intensity between the two groups were compared with independent t-test. It showed that the cyan and green fluorescence intensity in experimental group started to be different from that in control group in the 240th minute and 420th minute separately. The expression time of GFP was delayed to 180mins post CFP.</p>
+
 
+
<h3>2. AHL Gradient Induction</h3>
+
 
+
<p>We found that the concentration of AHL could have an effect on the expression of our circuits, in order to find out the relation, we decided to make a AHL gradient induction for our gene circuits. As shown in the graph, the fluorescence intensity data and time on the AHL of different concentrations show the the relationship of AHL to the expression of our circuits.</p>
+
  
 
<center><img src="https://static.igem.org/mediawiki/2016/8/8b/T--XMU-China--result_fig1_3_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 
<center><img src="https://static.igem.org/mediawiki/2016/8/8b/T--XMU-China--result_fig1_3_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
<p><center><strong> Figure 1.3 </strong>The mean CFP intensity in <em>E. coli</em> and its variety with time on the AHL of 1ng/&mu;L, 10ng/&mu;L, 20ng/&mu;L and 0ng/&mu;L.</center></p>
+
<p><center><strong> Figure 1.3 </strong>The average green fluorescence intensity versus time of experimental group 1, 10, 20 and control. </center></p><br/>
 +
<p>T-test showed that AHL didn't influence the expression of GFP directly. Group 10 and 20 expressed initially in the 420th minute and green fluorescence intensity had no significant difference in expression level. However, as for group 1, green fluorescence intensity didn’t show much difference comparing with control group, which meant that 1 ng/&mu;L of AHL was not enough to activated the sensor successfully. As a result, the repression on the P<sub>lac</sub> cannot be released, and the expression of <i>gfp</i> still stayed in a low level. So the sensor part is an specific and smart device. </p>
  
<p>AHL would influenced the expression of CFP directly. The higher the concentration of AHL was, the more CFP expressed in a range from 1ng/&mu;L to 10ng/&mu;L. In addition, the expression time of CFP was different. T-test showed that CFP in 10ng/&mu;L and 20ng/&mu;L group started to express in the 240th minute and it started to express in the 480th minute in 1ng/&mu;L group.</p>
+
<h3>2. The Delayed Effect</h3>
 +
<center><img src="https://static.igem.org/mediawiki/2016/5/53/T--XMU-China--result_fig1_4_1.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 +
<p><center><strong> Figure 1.4 </strong>The average cyan and green fluorescence intensity versus time of experimental group 20 and control.</center></p>
 +
<center><img src="https://static.igem.org/mediawiki/2016/0/06/T--XMU-China--result_fig1_5_1.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 +
<p><center><strong> Figure 1.5 </strong>The average cyan and green fluorescence intensity versus time of experimental group 10 and control.</center></p><br/>
  
<center><img src="https://static.igem.org/mediawiki/2016/3/37/T--XMU-China--result_fig1_4_.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
+
<p>As mentioned above, we did analyze the fluorescence intensity data by means of t-test to show that if there was a significant variation between experiment groups and control. And then, we get the initial expression time of CFP/ GFP in experiment groups and control. For group 10 and 20, the initial expression time of CFP was the 240th minute and GFP was detected at the 420th minute. From the results, we could draw the conclusion that the expression time of GFP was delayed to 180mins post CFP, which was the same as our expectation. So the <strong>Sensor</strong> and <strong>switch</strong> expressed as expected and match with each other very well. </p>
<p><center><strong> Figure 1.4 </strong>The mean GFP intensity in <em>E. coli</em> and its variety with time on the AHL of 1ng/&mu;L, 10ng/&mu;L, 20ng/&mu;L and 0ng/&mu;L.</center></p>
+
<h1 style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
 +
    padding-bottom: -5%;">Responder test
 +
</h1>
 +
<p>Against the backdrop of today's widely spread of drug-resistant bacteria, small regulatory RNA (sRNA) offers a new clinical therapy approach to repress the target drug-resistant genes and then it can enhance the effect of antibiotic in the clinical. Here we designed synthetic sRNA to target the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) to generate representative data and to quantify knockdown effectiveness.</p>
 +
<p>We designed and synthetized RNA silencing cassettes (<strong>Table 1</strong>) and constructed it into pSB1AC3, an official plasmid which contained ampicillin resistance gene and chloramphenicol resistance gene. Also, we used pSB1AC3+mRFP as control.</p>
 +
<center><img src="https://static.igem.org/mediawiki/2016/3/3a/T--XMU-China--result_fig1_2_1.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 +
<p><center><strong> Figure 2.1 </strong>The diagram of synthetized RNA silencing cassettes and control.</center></p>
 +
<div class="table-responsive"><br/>
 +
            <table class="table table-hover table-striped" width="100%" style="color:#8968CD;font-size:14px">
 +
<thead>
 +
<tr>
 +
<th>Part</th>
 +
<th>Sequence</th>
 +
</tr>
 +
</thead>  
  
<p>The concentration of AHL didn't influence the expression of GFP directly. The GFP in 10ng/&mu;L and 20ng/&mu;L group started to express in the 420th minute and it had no significant difference in expression level. The GFP didn’t express in 1ng/&mu;L group.</p>
+
<tbody>
 +
<tr>
 +
<td>pR promoter</td>
 +
<td>TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC</td>
 +
</tr>  
  
 +
<tr>
 +
<td>GUIDE sequence</td>
 +
<td>ATATCCAGTGATTTTTTTCTCCAT</td>
 +
</tr>
  
<h1 id="section-3"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
+
<tr>
    padding-bottom: -5%;">Responder test
+
<td>Hfq binding domain</td>
</h1>
+
<td>TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGA<br/>CAAGCCCGAACAGTCGTCCGGGCTTTTTTTCTCGAG</td>  
 +
</tr>  
  
 +
<tr>
 +
<td>T1/TE terminator</td>
 +
<td>TTTCGTTTTATCTGTTTTTGTCGGTGAACGCTCTCTACTAGAGTCACACT<br/>GGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA</td>
 +
</tr>
  
<h1 id="section-4"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
+
</tbody>
 +
</table>
 +
</div>
 +
<p><center><strong>Table 1</strong> The sequence of synthetized RNA silencing cassettes</center></p>
 +
<p>Firstly, we designed and synthetized RNA silencing cassettes and construct it into pSB1AC3, an official plasmid which contains amp and cm resistance gene. Also, we used pSB1AC3+mRFP as control. Then we transfer the plasmids into chemical competent cell (DH5&alpha;) and add chloramphenicol of 50&mu;g/ml to detect the knockdown effectiveness through the phenotype of survival index. We continuously measured the OD600 through the Bioscreen.</p>
 +
<center><img src="https://static.igem.org/mediawiki/2016/0/0f/T--XMU-China--result_fig1_2_2.png" width="80%;" align="center"; style="margin-bottom:20px;"/></center>
 +
<p><center><strong> Figure 2.2 </strong>The growth curves of bacteria with the sRNA cassettes or mRFP on the chloramphenicol of 50ng/&mu;L.</center></p><br/>
 +
<p>The growth of chemical competent cells(DH5&alpha;) with pSB1AC3+sRNA is significant repressed by the chloramphenicol (50&mu;g/mL) compared with the control with pSB1AC3+mRFP (The blue line). It indicated the sRNA’s highly knockdown effectiveness.</p>
 +
<p>From the result, we can found the OD600 of control group shows S-type growth trend. But the experimental group shows a low level all the time. It <span id="section-4">suggests</span> the growth of the bacteria which contain the sRNA cassettes significantly repressed by the chloramphenicol, which indicates the sRNA’s highly knockdown effectiveness.</p>
 +
<h1 style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
 
     padding-bottom: -5%;">Model
 
     padding-bottom: -5%;">Model
 
</h1>
 
</h1>
 
 
<p><strong>Abstract</strong>: <em>E. coli</em> has been modified in order to produce small interfering RNA molecules (siRNA) to attack the resistance genes that become available for nearby bacteria, when a resistant strain goes through lysis. However, a regulation system should be applied so the productive cells do not become a problem. A circuit has been implemented, this circuit regulates the transcription of said siRNAs among the production of toxins that could lead to death of any nearby cell, including the siRNA producers themselves. Taking in consideration all these elements a mathematical model using differential equations has been designed to approach the number of viable cells within the toxic environment once the circuit has been activated.</p>
 
<p><strong>Abstract</strong>: <em>E. coli</em> has been modified in order to produce small interfering RNA molecules (siRNA) to attack the resistance genes that become available for nearby bacteria, when a resistant strain goes through lysis. However, a regulation system should be applied so the productive cells do not become a problem. A circuit has been implemented, this circuit regulates the transcription of said siRNAs among the production of toxins that could lead to death of any nearby cell, including the siRNA producers themselves. Taking in consideration all these elements a mathematical model using differential equations has been designed to approach the number of viable cells within the toxic environment once the circuit has been activated.</p>
 
<p><em><strong>Keywords</strong>: siRNA, toxin, mRNA, transcription, translation, exponential</p></em>
 
<p><em><strong>Keywords</strong>: siRNA, toxin, mRNA, transcription, translation, exponential</p></em>
  
<h3>Rate of production of toxin mRNA and toxin molecules</h3>
+
<h3><strong>Rate of production of toxin mRNA and toxin molecules</strong></h3>
<p>The toxins are produced through a gene inside the circuit, so the production of toxin depends on the translation of the mRNA produced, which also depends on transcription variables. A differential equation was taken in consideration in order to measure the mRNA rate production.</p>
+
<p>The toxins are produced through a gene in the circuit, so the production of toxin depending on the translation of the mRNA produces, which also depends on transcription variables. A differential equation was taken in consideration in order to measure the mRNA rate production.</p>
  
 
<center>$$\frac{dr}{dt} = K - D_{r}*r$$</center>
 
<center>$$\frac{dr}{dt} = K - D_{r}*r$$</center>
  
<p>K represents the transcription rate, which is a constant parameter, in molecules of RNA per second, Dr is the degradation rate expressed in units per seconds as it depends on how much mRNA is actually present on the cell, expressed by the variable “r” in units of molecules of mRNA produced.</p>
+
<p>\(K\) represents the transcription rate, which is a constant parameter, in molecules of RNA per second, \(D_{r}\) is the degradation rate expressed in units per seconds as it depends on how much mRNA is actually present on the cell, expressed by the variable "\(r\)" in units of molecules of mRNA produced.</p>
  
 
<center>$$r = \frac{K}{D_{r}}+Ce^{-D_{r}t}$$</center>
 
<center>$$r = \frac{K}{D_{r}}+Ce^{-D_{r}t}$$</center>
  
 
<p>Afterwards, the original mRNA production equation was obtained through the integration of the differential equation by linear integration.</p>
 
<p>Afterwards, the original mRNA production equation was obtained through the integration of the differential equation by linear integration.</p>
<p>Establishing a new condition r(0)=R<sub>0</sub> then we can complete the system. Substituting we obtain:</p>
+
<p>Establishing a new condition \(r(0)=R_{0}\) then we can complete the system. Substituting we obtain:</p>
  
 
<center>$$R_{0} = \frac{K}{D_{r}}+C \rightarrow C = R_{0}-\frac{K}{D_{r}}$$</center>
 
<center>$$R_{0} = \frac{K}{D_{r}}+C \rightarrow C = R_{0}-\frac{K}{D_{r}}$$</center>
Line 281: Line 327:
 
<p>To simplify the model we assume that each mRNA molecule will be transcribed in order to produce one molecule of protein. This means that each molecule of mRNA produced is equivalent to one molecule of active toxin that in certain concentration can kill bacteria. We assume a fast degradation of mRNA inside the system and almost no significant dispersion of the molecules, so this ratio can be respected.</p>
 
<p>To simplify the model we assume that each mRNA molecule will be transcribed in order to produce one molecule of protein. This means that each molecule of mRNA produced is equivalent to one molecule of active toxin that in certain concentration can kill bacteria. We assume a fast degradation of mRNA inside the system and almost no significant dispersion of the molecules, so this ratio can be respected.</p>
  
<h3>Productive cells inside the system</h3>
+
<h3><strong>Productive cells inside the system</strong></h3>
<p>The number of E. coli cells within the system can not be considered as a constant, neither as a linear function due to the exponential nature of cellular division. Given normal growth of the cell culture, it is possible to describe the number of E. coli cells as a function of time. Nevertheless, the E. coli concerning the model produces toxins that alter the number of E. coli cells itself, also there is a natural decrease in the number of bacteria caused by cellular death, resulting in the addition of new terms to the traditional equation. An equation considering all the previous factors is shown below.</p>
+
<p>The number of <em>E. coli</em> cells within the system can not be considered as a constant, neither as a linear function due to the exponential nature of cellular division. Given normal growth of the cell culture, it is possible to describe the number of <em>E. coli</em> cells as a function of time. Nevertheless, the <em>E. coli</em> concerning the model produces toxins that alter the number of <em>E. coli</em> cells itself, also there is a natural decrease in the number of bacteria caused by cellular death, resulting in the addition of new terms to the traditional equation. An equation considering all the previous factors is shown below.</p>
  
 
<center>$$C(t)=C_{0}e^{Gt}(1-D)-M*C$$</center>
 
<center>$$C(t)=C_{0}e^{Gt}(1-D)-M*C$$</center>
Line 289: Line 335:
  
 
<p>Where:<br/>
 
<p>Where:<br/>
C<sub>0</sub>: Initial population [=] cells<br/>
+
\(C_{0}\): Initial population [=] cells<br/>
C: Total productive cells [=] cells<br/>
+
\(C\): Total productive cells [=] cells<br/>
D: Cell fraction ( \(C_{0}e^{Gt}(1-D))\ ) ​that dies naturally [=] adimensional < 1<br/>
+
\(D\): Cell fraction ( \(C_{0}e^{Gt}(1-D)\) ) ​that dies naturally [=] adimensional < 1<br/>
G: Rate of cells that are born [=] 1/second<br/>
+
\(G\): Rate of cells that are born [=] 1/second<br/>
M: Fraction of viable cells ( <em>C<sub>0</sub>e<sup>Gt</sup>(1-D)</em> ) that lyse due to toxins [=] adimensional < 1 <br/>
+
\(M\): Fraction of viable cells ( \(C_{0}e^{Gt}(1-D)\) ) that lyse due to toxins [=] adimensional < 1 <br/>
D and M are not related, therefore they are independent. It is also important to notice that we assumed that the number of toxins equals the number of mRNAs transcribed, so our previous defined function r(t) can help us to determine the constant M. </p>
+
\(D\) and \(M\) are not related, therefore they are independent. It is also important to notice that we assumed that the number of toxins equals the number of mRNAs transcribed, so our previous defined function \(r(t)\) can help us to determine the constant \(M\). </p>
  
<p><center>r(t) < X: no cell death, M = 0</center></p>
+
<p><center>\(r(t) < X\): no cell death, \(M = 0\)</center></p>
<p><center>r(t) >= X: cell death occurs, <img src="https://static.igem.org/mediawiki/2016/c/cc/T--XMU-China--result_2016_mathtype_6.png" width="15%;" align="center"; style="margin-bottom:20px;"/> < 1 </center></p>
+
<p><center>\(r(t) \geqslant X\): cell death occurs, \(M=\frac{T r(t)}{(1-D)C_{0}e^{Gt}}\) < 1 </center></p>
<p>where X is the critical toxin production rate. Also in order to determine the M term we need other variables.</p>
+
<p>where \(X\) is the critical toxin production rate. Also in order to determine the \(M\) term we need other variables.</p>
<p><img src="https://static.igem.org/mediawiki/2016/c/cc/T--XMU-China--result_2016_mathtype_6.png" width="15%;" align="center"; style="margin-bottom:20px;"/>, where:</p>
+
<p>\(M=\frac{T r(t)}{(1-D)C_{0}e^{Gt}}\), where:</p>
  
<p>r(t) = toxins produced in time t [=] (molecule of toxin)<br/>
+
<p>\(r(t)\) = toxins produced in time \(t\) [=] (molecule of toxin)<br/>
T = cells that die by unit of toxin [=] (cells / molecule of toxin)<br/>
+
\(T\) = cells that die by unit of toxin [=] (cells / molecule of toxin)<br/>
M = dead cells / total viable cells [=] adimensional<br/>
+
\(M\) = dead cells / total viable cells [=] adimensional<br/>
 
</p>
 
</p>
  
<p><center>for r(t) < X: <em>C(t) = C<sub>0</sub>e<sup>Gt</sup>(1 − D)</em> (3)</center></p>
+
<p><center>for \(r(t) < X\): \(C(t) = C_{0}e^{Gt}(1 − D)\) (3)</center></p>
<p><center>for r(t) >= X: <img src="https://static.igem.org/mediawiki/2016/c/c4/T--XMU-China--result_2016_mathtype_7.png" width="33%;" align="bottom"; style="margin-bottom:20px;"/> (4) then</center></p>
+
<p><center>for \(r(t) \geqslant X\): \(C(t)= C_{0}e^{Gt}(1-D)(1-\frac{T r(t)}{(1-D)C_{0e^{Gt}}})\) (4) then</center></p>
<p><center><em>C(t) = C<sub>0</sub>e<sup>Gt</sup>(1 − D) − T r(t)</em> (5)</center></p>
+
<p><center>\(C(t) = C_{0}e^{Gt}(1 − D) − T r(t)\) (5)</center></p>
<p>The coupled equations yield the following final modelling:
+
<p id="section-5">The coupled equations yield the following final modelling:
 
</p>
 
</p>
 
<center>$$C(t)=C_{0}e^{Gt}(1-D)- T[\frac{K}{D_{r}}+(R_{0}-\frac{K}{D_{r}})e^{-D_{r}t}]$$</center>
 
<center>$$C(t)=C_{0}e^{Gt}(1-D)- T[\frac{K}{D_{r}}+(R_{0}-\frac{K}{D_{r}})e^{-D_{r}t}]$$</center>
  
 
+
<h1 style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
 
+
    padding-bottom: -5%;">Discussion
 
+
</h1>
<h1 id="section-5"; style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
+
<p>From the experiment results, we found that the entire gene circuits can express well. <strong>Sensor</strong> was a specific and smart device, which could detect the quorum sensing molecules AHL and activated the following gene circuits when AHL reached threshold value and stayed “off” state under the threshold value. <strong>Switch</strong> was a perfect device, which delay the expression of lysis (represented by <i>gfp</i>) so that responder (represented by <i>cfp</i>) had enough time to express. Also, responder test showed that sRNA is a dramatically weapon with high knockdown effectiveness. So if we connected these perfect parts into a synthetic biological device and transformed it into chemical competent cell (DH5&alpha;), we can get powerful bacterial soldier to fight and beat antibiotic resistant bacteria.</p>
 +
<h1 style="border-bottom: 1px solid #aaa;color: #8968CD;text-shadow: 0 0 1px black;margin-bottom:.6em;padding-top: 0;
 
     padding-bottom: -5%;">Reference
 
     padding-bottom: -5%;">Reference
 
</h1>
 
</h1>
 
+
<p>[1] Bernheim, A. G., Libis, V. K., Lindner, A. B. & Wintermute, E. H. Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in <i>E.coli</i>. <i>J. Vis. Exp.</i> <strong>109</strong>, 1–10(2016). <br/>
 +
[2] Kobayashi, H., Kærn, M. & Araki, M. et al. Programmable cells: Interfacing natural and engineered gene networks. <i>PNAS</i> <strong>101</strong>, 8414-8419(2004).
 +
</p>
 
</div>
 
</div>
 
</div>
 
</div>
Line 335: Line 384:
 
<img src="https://static.igem.org/mediawiki/2016/5/55/T--XMU-China--main-logo_and_.png" style="width: 10%; display: inline-block; margin-left: 6%;margin-top:-7%;" />
 
<img src="https://static.igem.org/mediawiki/2016/5/55/T--XMU-China--main-logo_and_.png" style="width: 10%; display: inline-block; margin-left: 6%;margin-top:-7%;" />
  
<a href="http://www.xmu.edu.cn/" target="_blank"><img src="https://static.igem.org/mediawiki/2016/d/de/T--XMU-China--xmulogo_and_.png" style="width: 9%; display: inline-block; margin-left: 6%;margin-top:-6%;" /></a>
+
<a href="http://en.xmu.edu.cn/" target="_blank"><img src="https://static.igem.org/mediawiki/2016/d/de/T--XMU-China--xmulogo_and_.png" style="width: 9%; display: inline-block; margin-left: 6%;margin-top:-6%;" /></a>
 
<img src="https://static.igem.org/mediawiki/2016/f/f0/T--XMU-China--foot-xmuname_and_.png" style="width: 15%; display: inline-block; margin-left: 1%;margin-top:-6%;" />  
 
<img src="https://static.igem.org/mediawiki/2016/f/f0/T--XMU-China--foot-xmuname_and_.png" style="width: 15%; display: inline-block; margin-left: 1%;margin-top:-6%;" />  
  
Line 349: Line 398:
 
<span style="font-size: 14px; color: #fff; margin-top: 10%; margin-bottom: 0px;padding-left:3%;">igemxmu@gmail.com</span>
 
<span style="font-size: 14px; color: #fff; margin-top: 10%; margin-bottom: 0px;padding-left:3%;">igemxmu@gmail.com</span>
 
</div>
 
</div>
 
 
 
</div>
 
</div>
 
</div>
 
</div>
Line 393: Line 440:
 
window.onload = function(){  
 
window.onload = function(){  
 
     setTimeout("$('#loader').fadeOut('fast')",1000)
 
     setTimeout("$('#loader').fadeOut('fast')",1000)
 +
  var obtn=document.getElementById('btn');
 +
var clientHeight=document.documentElement.clientHeight;
 +
var timer=null;
 +
var isTop=true;
 +
 +
window.onscroll=function(){
 +
var osTop=document.documentElement.scrollTop||document.body.scrollTop;
 +
if(osTop>=clientHeight){
 +
obtn.style.display='block';
 +
}else{obtn.style.display='none';}
 +
if(!isTop){
 +
clearInterval(timer);
 +
}
 +
isTop=false;
 +
}
 +
 +
obtn.onclick=function(){
 +
timer=setInterval(function(){
 +
var osTop=document.documentElement.scrollTop||document.body.scrollTop;
 +
var ispeed=Math.floor(-osTop/6);
 +
document.documentElement.scrollTop=document.body.scrollTop=osTop+ispeed;
 +
 +
isTop=true;
 +
if(osTop==0)
 +
{
 +
clearInterval(timer);
 +
}
 +
},30);
 +
}
 
};
 
};
 
</script>
 
</script>

Latest revision as of 01:45, 20 October 2016

Proof Of Concept

Verities never lie.

Entire circuits test

In our experiment, for testing our circuit more conveniently, we use CFP to replace the responder and use GFP to replace lysis. Because the fluorescence intensity is easier to be measured. Also, the intensity of the fluorescence can stand for the intensity of the corresponding genes' expression.

When the concentration of AHL is at low concentration, AHL cannot be detected by the quorum sensing system. And as a consequence, there is no enough inhibitor lacI to repress promoter Plac. So the cI gene is expressing at the wild-type levels. While lacI-2 and GFP are repressed since the CI protein is at high concentration. When AHL around the engineered bacteria reached a certain concentration or a threshold value, AHL could be detected by the sensing molecules Lux R. Then, Lux R interacted with AHL and form activating molecules to activate promoter Lux pR. CFP and lacI-1 express, and CFP protein could be detected by fluorescence measurement. And the lacI-1's product-lacR protein could inhibit the expression of cI gene. As a result, lacI-2 and GFP expressed. The lacI-2's product could further repress cI gene's expression, which was a negative feedback system. GFP could be measured by fluorescence detection to represent the level of lysis gene's expression. The time of initial expression of CFP and GFP were different. As a result, the interval of time could represent the delay time which the switch give for responder expression.

1. AHL Gradient Induction

As we can see, quorum sensing system could be induced by AHL. As for our gene circuits, when AHL raised to its threshold value and was detected by the sensor part, the promoter Lux PR can be activated, CFP and GFP are expressed. In order to find out the relationship, we decided to make an AHL gradient induction for our gene circuits.

During our experiment, we first constructed our gene circuit successfully, then we transformed the plasmids into chemical competent cell (DH5α). And then our engineering bacteria were divided into four groups: experimental group 1, 10 and 20 (c(AHL) = 1 ng/μL, 10 ng/μL, and 20 ng/μL) and blank control group. Then we measured OD600 of the E.coli and the fluorescence intensity of CFP and GFP for 900 minutes. The OD600 showed the growth trend of the engineering bacteria. And the fluorescence intensity of each group showed the relationship between AHL and the expression of our circuits.

Figure 1.1 The OD600 of versus time of experimental group 1, 10, 20 and control

From figure 1.1, we found that the growth curves of each group don't show much difference. It suggested that they had the same growth trend, so the difference of fluorescence intensity was mainly from the expression of circuits or other factors.

Figure 1.2The average cyan fluorescence intensity versus time of experimental group 1, 10, 20 and control.

So we did experiments at the same condition except the concentration of AHL. As showed in figure 1.2, with the increase of the AHL, the expression of the CFP showed an upper trend. In addition, by means of independent t-test, we compared the fluorescence intensity between the group 1, 10, 20 and control. We found the initial expression time of CFP was different. For group 10 and 20, CFP expressed initially and could be detected in the 240th minute. However, for group 1, CFP started to express in the 480th minute.

Figure 1.3 The average green fluorescence intensity versus time of experimental group 1, 10, 20 and control.


T-test showed that AHL didn't influence the expression of GFP directly. Group 10 and 20 expressed initially in the 420th minute and green fluorescence intensity had no significant difference in expression level. However, as for group 1, green fluorescence intensity didn’t show much difference comparing with control group, which meant that 1 ng/μL of AHL was not enough to activated the sensor successfully. As a result, the repression on the Plac cannot be released, and the expression of gfp still stayed in a low level. So the sensor part is an specific and smart device.

2. The Delayed Effect

Figure 1.4 The average cyan and green fluorescence intensity versus time of experimental group 20 and control.

Figure 1.5 The average cyan and green fluorescence intensity versus time of experimental group 10 and control.


As mentioned above, we did analyze the fluorescence intensity data by means of t-test to show that if there was a significant variation between experiment groups and control. And then, we get the initial expression time of CFP/ GFP in experiment groups and control. For group 10 and 20, the initial expression time of CFP was the 240th minute and GFP was detected at the 420th minute. From the results, we could draw the conclusion that the expression time of GFP was delayed to 180mins post CFP, which was the same as our expectation. So the Sensor and switch expressed as expected and match with each other very well.

Responder test

Against the backdrop of today's widely spread of drug-resistant bacteria, small regulatory RNA (sRNA) offers a new clinical therapy approach to repress the target drug-resistant genes and then it can enhance the effect of antibiotic in the clinical. Here we designed synthetic sRNA to target the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) to generate representative data and to quantify knockdown effectiveness.

We designed and synthetized RNA silencing cassettes (Table 1) and constructed it into pSB1AC3, an official plasmid which contained ampicillin resistance gene and chloramphenicol resistance gene. Also, we used pSB1AC3+mRFP as control.

Figure 2.1 The diagram of synthetized RNA silencing cassettes and control.


Part Sequence
pR promoter TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC
GUIDE sequence ATATCCAGTGATTTTTTTCTCCAT
Hfq binding domain TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGA
CAAGCCCGAACAGTCGTCCGGGCTTTTTTTCTCGAG
T1/TE terminator TTTCGTTTTATCTGTTTTTGTCGGTGAACGCTCTCTACTAGAGTCACACT
GGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA

Table 1 The sequence of synthetized RNA silencing cassettes

Firstly, we designed and synthetized RNA silencing cassettes and construct it into pSB1AC3, an official plasmid which contains amp and cm resistance gene. Also, we used pSB1AC3+mRFP as control. Then we transfer the plasmids into chemical competent cell (DH5α) and add chloramphenicol of 50μg/ml to detect the knockdown effectiveness through the phenotype of survival index. We continuously measured the OD600 through the Bioscreen.

Figure 2.2 The growth curves of bacteria with the sRNA cassettes or mRFP on the chloramphenicol of 50ng/μL.


The growth of chemical competent cells(DH5α) with pSB1AC3+sRNA is significant repressed by the chloramphenicol (50μg/mL) compared with the control with pSB1AC3+mRFP (The blue line). It indicated the sRNA’s highly knockdown effectiveness.

From the result, we can found the OD600 of control group shows S-type growth trend. But the experimental group shows a low level all the time. It suggests the growth of the bacteria which contain the sRNA cassettes significantly repressed by the chloramphenicol, which indicates the sRNA’s highly knockdown effectiveness.

Model

Abstract: E. coli has been modified in order to produce small interfering RNA molecules (siRNA) to attack the resistance genes that become available for nearby bacteria, when a resistant strain goes through lysis. However, a regulation system should be applied so the productive cells do not become a problem. A circuit has been implemented, this circuit regulates the transcription of said siRNAs among the production of toxins that could lead to death of any nearby cell, including the siRNA producers themselves. Taking in consideration all these elements a mathematical model using differential equations has been designed to approach the number of viable cells within the toxic environment once the circuit has been activated.

Keywords: siRNA, toxin, mRNA, transcription, translation, exponential

Rate of production of toxin mRNA and toxin molecules

The toxins are produced through a gene in the circuit, so the production of toxin depending on the translation of the mRNA produces, which also depends on transcription variables. A differential equation was taken in consideration in order to measure the mRNA rate production.

$$\frac{dr}{dt} = K - D_{r}*r$$

\(K\) represents the transcription rate, which is a constant parameter, in molecules of RNA per second, \(D_{r}\) is the degradation rate expressed in units per seconds as it depends on how much mRNA is actually present on the cell, expressed by the variable "\(r\)" in units of molecules of mRNA produced.

$$r = \frac{K}{D_{r}}+Ce^{-D_{r}t}$$

Afterwards, the original mRNA production equation was obtained through the integration of the differential equation by linear integration.

Establishing a new condition \(r(0)=R_{0}\) then we can complete the system. Substituting we obtain:

$$R_{0} = \frac{K}{D_{r}}+C \rightarrow C = R_{0}-\frac{K}{D_{r}}$$

We finally obtain the equation for mRNA synthesis:

$$r(t)= \frac{K}{D_{r}}+(R_{0}-\frac{K}{D_{r}})e^{-D_{r}t}$$

To simplify the model we assume that each mRNA molecule will be transcribed in order to produce one molecule of protein. This means that each molecule of mRNA produced is equivalent to one molecule of active toxin that in certain concentration can kill bacteria. We assume a fast degradation of mRNA inside the system and almost no significant dispersion of the molecules, so this ratio can be respected.

Productive cells inside the system

The number of E. coli cells within the system can not be considered as a constant, neither as a linear function due to the exponential nature of cellular division. Given normal growth of the cell culture, it is possible to describe the number of E. coli cells as a function of time. Nevertheless, the E. coli concerning the model produces toxins that alter the number of E. coli cells itself, also there is a natural decrease in the number of bacteria caused by cellular death, resulting in the addition of new terms to the traditional equation. An equation considering all the previous factors is shown below.

$$C(t)=C_{0}e^{Gt}(1-D)-M*C$$
$$C(t)=C_{0}e^{Gt}(1-D)-M*C_{0}e^{Gt}(1-D)$$
$$C(t)=C_{0}e^{Gt}(1-D)(1-M)$$

Where:
\(C_{0}\): Initial population [=] cells
\(C\): Total productive cells [=] cells
\(D\): Cell fraction ( \(C_{0}e^{Gt}(1-D)\) ) ​that dies naturally [=] adimensional < 1
\(G\): Rate of cells that are born [=] 1/second
\(M\): Fraction of viable cells ( \(C_{0}e^{Gt}(1-D)\) ) that lyse due to toxins [=] adimensional < 1
\(D\) and \(M\) are not related, therefore they are independent. It is also important to notice that we assumed that the number of toxins equals the number of mRNAs transcribed, so our previous defined function \(r(t)\) can help us to determine the constant \(M\).

\(r(t) < X\): no cell death, \(M = 0\)

\(r(t) \geqslant X\): cell death occurs, \(M=\frac{T r(t)}{(1-D)C_{0}e^{Gt}}\) < 1

where \(X\) is the critical toxin production rate. Also in order to determine the \(M\) term we need other variables.

\(M=\frac{T r(t)}{(1-D)C_{0}e^{Gt}}\), where:

\(r(t)\) = toxins produced in time \(t\) [=] (molecule of toxin)
\(T\) = cells that die by unit of toxin [=] (cells / molecule of toxin)
\(M\) = dead cells / total viable cells [=] adimensional

for \(r(t) < X\): \(C(t) = C_{0}e^{Gt}(1 − D)\) (3)

for \(r(t) \geqslant X\): \(C(t)= C_{0}e^{Gt}(1-D)(1-\frac{T r(t)}{(1-D)C_{0e^{Gt}}})\) (4) then

\(C(t) = C_{0}e^{Gt}(1 − D) − T r(t)\) (5)

The coupled equations yield the following final modelling:

$$C(t)=C_{0}e^{Gt}(1-D)- T[\frac{K}{D_{r}}+(R_{0}-\frac{K}{D_{r}})e^{-D_{r}t}]$$

Discussion

From the experiment results, we found that the entire gene circuits can express well. Sensor was a specific and smart device, which could detect the quorum sensing molecules AHL and activated the following gene circuits when AHL reached threshold value and stayed “off” state under the threshold value. Switch was a perfect device, which delay the expression of lysis (represented by gfp) so that responder (represented by cfp) had enough time to express. Also, responder test showed that sRNA is a dramatically weapon with high knockdown effectiveness. So if we connected these perfect parts into a synthetic biological device and transformed it into chemical competent cell (DH5α), we can get powerful bacterial soldier to fight and beat antibiotic resistant bacteria.

Reference

[1] Bernheim, A. G., Libis, V. K., Lindner, A. B. & Wintermute, E. H. Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E.coli. J. Vis. Exp. 109, 1–10(2016).
[2] Kobayashi, H., Kærn, M. & Araki, M. et al. Programmable cells: Interfacing natural and engineered gene networks. PNAS 101, 8414-8419(2004).

Name: XMU-China School: Xiamen University


Address: Xiamen University, No. 422, Siming South Road, Xiamen, Fujian, P. R. China 361005

Name: XMU-China School: Xiamen University


Address: Xiamen University, No. 422, Siming South Road, Xiamen, Fujian, P. R. China 361005