Line 16: | Line 16: | ||
<p style = "font-size:150%; padding:25px 150px 20px 150px; color:#0071A7;"> | <p style = "font-size:150%; padding:25px 150px 20px 150px; color:#0071A7;"> | ||
− | We submitted several parts from our Gemini Library to the registry, including two of our guide RNA expression vectors as basic parts for our Bronze Medal requirement. You can find these parts by searching for <a href = "http://parts.igem.org/Part:BBa_K1875011" style = "color:blue;">BBa_K1875011</a> and <a href = "http://parts.igem.org/Part:BBa_K1875012" style = "color:blue;">BBa_K1875012</a>. These contain the target sequences for guide RNA 3 and guide RNA 8 respectively. BBa_K1875011 express g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003</p> | + | We submitted several parts from our Gemini Library to the registry, including two of our guide RNA expression vectors as basic parts for our <a href = "https://2016.igem.org/Team:BostonU/Medal_Criteria" style = "color:blue;">Bronze Medal requirement</a>. You can find these parts by searching for <a href = "http://parts.igem.org/Part:BBa_K1875011" style = "color:blue;">BBa_K1875011</a> and <a href = "http://parts.igem.org/Part:BBa_K1875012" style = "color:blue;">BBa_K1875012</a>. These contain the target sequences for guide RNA 3 and guide RNA 8 respectively. BBa_K1875011 express g3, a guide RNA that directly recognizes the 20bp target sequence 5’-AATGAACCTATTCGTACCGT-3’. This 20bp target sequence can be found in composite part <a href = "http://parts.igem.org/Part:BBa_K1875003" style = "color:blue;">BBa_K1875003</a></p> |
</div> | </div> |
Revision as of 17:19, 15 October 2016
Welcome to the BostonU Parts Pages. We will be brief here but if you would like more detailed information on the parts associated with Gemini we recommend you visit our various pages on the iGEM BioBrick Registry.
We submitted several parts from our Gemini Library to the registry, including two of our guide RNA expression vectors as basic parts for our Bronze Medal requirement. You can find these parts by searching for BBa_K1875011 and BBa_K1875012. These contain the target sequences for guide RNA 3 and guide RNA 8 respectively. BBa_K1875011 express g3, a guide RNA that directly recognizes the 20bp target sequence 5’-AATGAACCTATTCGTACCGT-3’. This 20bp target sequence can be found in composite part BBa_K1875003
In addition to the Bronze Medal parts, we submitted a selection of guide RNA operator reporters for Silver Medal consideration. Those parts include BBa_K1875013 (single site with guide 1), BBa_K1875014 (single site with guide 3), BBa_K1875015 (single site with guide 8), BBa_K1875016(single site with guide 13), BBa_K1875017 (double site with guide 13), BBa_K1875018 (triple site with guide 13), BBa_K1875019 (mutated guide 13).
The above parts are all considered composite parts, and thus a collection of basic parts was pages was created on the Registry. These include the various target sequences, the minimal CMV promoter, a Kozak sequence, a GFP protein, and a Rabbit Beta Globin Poly A terminator. These parts have the ID numbers BBa_K1875000 - BBa_K1875010. These parts do not have samples in the registry, but their sequences are all available on their respective Registry pages.