Team:NEU-China/ExperimentResults

Experiments & Results - NEU-China

Experiments & Results

Bacterial Strains and Growth Cultures

E. coli DH5α was used for all cloning purposes. The E. coli strains Bl21 was used as expression hosts. Cultures for cloning were grown in antibiotic-supplemented Lysogeny Broth (LB) at 37°C. The E. coli expression host cultures were grown in antibiotic-supplemented Lysogeny Broth (LB) at 37°C.

Bacterial cultures were grown overnight (16-20 hours) to stationary phase before being subcultured for characterization experiments.

Plasmid Construction & Gene Cloning

Part

Plasmid Construction

Transformation to Host Strain

tCas9-vp64-HA-FLAG PBD024 E.coli.DH5α
tCas9-CIBN-HA PBD024 E.coli.DH5α
CRY2-VP64-HA-FLAG PBD021 E.coli.DH5α
VP64-HA-FLAG SK- E.coli.DH5α
BioBrick-tCas9-vp64-HA-FLAG PSB1C3 E.coli.DH5α
BioBrick-tCas9-CIBN-HA PSB1C3 E.coli.DH5α
BioBrick-CRY2-VP64-HA-FLAG PSB1C3 E.coli.DH5α
BioBrick-tCas9 PSB1C3 E.coli.DH5α
BioBrick-CIBN-HA PSB1C3 E.coli.DH5α
BioBrick-CRY2 PSB1C3 E.coli.DH5α
BioBrick-vp64-HA-FLAG PSB1C3 E.coli.DH5α
tCas9-vp64-HA-FLAG pESC E.coli.DH5α
tCas9-CIBN-HA pESC E.coli.DH5α
CRY2-VP64-HA-FLAG pESC E.coli.DH5α
tCas9-vp64-HA-FLAG p426 E.coli.DH5α
tCas9-CIBN-HA p426 E.coli.DH5α
CRY2-VP64-HA-FLAG p426 E.coli.DH5α
tCas9-CIBN-HA PBD024 E.coli.BL21
CRY2-VP64-HA-FLAG PBD021 E.coli.BL21
BioBrick-GFP-CRY2-VP64-T7-gRNA pCold E.coli.BL21
BioBrick-GFP-T7-gRNA pCold E.coli.BL21
tCas9-vp64-HA-FLAG PBD024 E.coli.BL21

Results

According to our design, we transfected a targeting plasmid into E.coli BL21 to express fusion protein composed of the protein tCas9 and CIBN. Simultaneously, we transfected GFP, gRNA and CRY2-VP64 plasmid into E.coli BL21. Then, the promoter of GFP were continually repressed by gRNA and tCas9. When exposed to blue light, the N-terminal fragment of CIB1 (CIBN) would interact with CRY2. Subsequently, binding of the CRY2-VP64 on the upstream sequence of promoter will result in activating promoter via recruitment of the RNA polymerase II by the VP64 subunit of CRY2-VP64. Generally, the experimental procedure can be divided into four steps:

  1. Characterization of fusion protein
  2. Verification of the suppression efficiency of gRNA
  3. Silencing capability validation
  4. Targeting capability validation

Characterization of fusion protein


Figure 1: Validation of protein

CRY2-VP64:
Stationary cultures of BL21 J23114 was subcultured into fresh media and growth for 4 hours. Subsequent extraction of protein from bacterial and visualization using SDS-PAGE confirms that proteins of the expected size are present in the supernatant and hence most likely successfully secreted by the engineered bacterial strains.


Figure 2:Western blot analysis of CRY2-VP64 protein levels.
1:Control groups transfected with empty plasmid; 2 3 4:Transfected with CRY2-VP64 plasmid (J23114 promoter)
from different single colonies, ~78.5 kDa. Stationary cultures of BL21 was subcultured into fresh media and growth for
4 hours. 30ng of protein with total volume of 30ul (protein sample + dissociation buffer).

tCas9-CIBN:
Stationary cultures of BL21 pBAD was subcultured into fresh media and induced for 4 hours or 16 hours using different concentrations L-arabinose. Subsequent purification of protein from the cell-free supernatant and visualization using SDS-PAGE confirms that proteins of the expected size are present in the supernatant and hence most likely successfully secreted by the engineered bacterial strains.


Figure 3:Western blot analysis of tCas9-CIBN protein levels.
1 3 5 7 9 11:Control groups transfected with empty plasmid; 2 4 6 8 10 12: Transfected with tCas9-CIBN plasmid
(pBAD promoter), ~180 kDa . Stationary cultures of BL21 was subcultured into fresh media and growth for 4 hours or 16 hours using different concentrations L-arabinose. 30ng of protein with total volume of 30ul (protein sample + dissociation buffer).


Figure 4: Western blot analysis of tCas9-CIBN protein levels.
1 3 5 7 9 11:Control groups transfected with empty plasmid; 2 4 6 8 10 12: Transfected with tCas9-CIBN plasmid
(pBAD promoter), ~180 kDa . Stationary cultures of BL21 was subcultured into fresh media and growth for 4 hours or 16 hours using different concentrations L-arabinose. 30ng of protein with total volume of 30ul (protein sample + dissociation buffer).

Verification of the suppression efficiency of gRNA

With different target loci have been tested by the usage of a GFP reporter plasmid (pCold-1) with a CSPA promotor. The target sites can be determined by directing the gRNA consisting of 20 bp length against the desired sequence of interest. F1 gRNA with target sites at different distances to the promotor regions proved successfully as potential activation sites (see Table 1 and Figure 5).

Name Binding Site Distance to promoter Sequence Position
F1 CSPA promoter 15 TGCATCACCCGCCAATGCG sense sequences
F2 non-coding 68 GCCGCCGCAAGGAATGGTG sense sequences
R1 CSPA promoter 43 ATTAATCATAAATATGAAA antisense sequences
R2 non-coding 94 CATCATCCAACTCCGGCAAC antisense sequences

Table 1: Overview of the tested gRNAs with different binding sites on the GFP pCold-1 plasmid.


Figure 5: Position of the target loci on the GFP pCold-1 plasmid.

To ensure the suppression efficiency of the gRNA, four gRNA sequences targeting different sites of CSPA promoter were designed and transfected into the E. coli strains BL21. Efficient suppression of CSPA promoter in strains BL21 was observed. GFP levels in GFP transgenic strains decrease after inserting a fragment that expresses CSPA promoter gRNA. And the sequence with the best suppression effect was selected for further study.


Figure 6: Results of the GFP-influence under the CSPA promotor
only using different gRNAs targeted to CSPA promoter in BL21.

1-8: Transfected with different GFP-gRNA plasmid (CSPA promoter) 9:Control group transfected with GFP plasmid,~27 kDa. Excitation wavelength: 488 nm, Emission wavelength: 509nm. Stationary cultures of BL21 was subcultured into fresh media and growth for 8 hours (1 3 5 7 9) or 16 hours (2 4 6 8) at 30°C. 30ng of protein with total volume of 30ul (protein sample + dissociation buffer).

Silencing capability validation

We next evaluated the effect of tCas9-cibn on suppressing CSPA promoter. GFP expression levels were assayed in strains BL21 after co-transformation with tCas9-cibn and gRNA.


Figure 7: Silencing capability of tCas9-CIBN with gRNA
using different gRNAs targeted to CSPA promoter in BL21.

1-8: Transfected with different GFP-gRNA plasmid (CSPA promoter) and tCas9-CIBN plasmid (pBAD promoter)
9 10:Control groups transfected with GFP plasmid and tCas9-CIBN plasmid (pBAD promoter), ~27 kDa. Excitation wavelength: 488 nm, Emission wavelength: 509nm. Stationary cultures of BL21 was subcultured into fresh media and growth for 8 hours (1 3 5 7 9) or 16 hours (2 4 6 8 10) using 15mM L-arabinose at 30°C. 30ng of protein with total volume of 30ul (protein sample + dissociation buffer).

Compared with control groups, green fluorescence intensity and mRNA levels were dramatically reduced in groups treated with gRNA and tCas9-CIBN. These results suggest that gRNA can specifically guide tCas9 to target upstream of CSPA promoter, thereby to inhibit CSPA promoter to reduce GFP expression levels.

Activation capability validation

Spatially controlled activation of gene expression was achieved in strains co-transfected with the LACE system, a reporter vector containing a gRNA target sequence upstream of CSPA promoter and the eGFP gene. Strains transfected with light-activated CRISPR/Cas9 effector (LACE) and incubated in the dark did not show a significant difference in eGFP levels compared to control groups transfected with empty plasmid. Strains containing the LACE system and gRNA exhibited significantly brighter eGFP fluorescence intensity when illuminated compared to when incubated in the dark. Activation of the eGFP reporter in strains transfected with the gRNA and LACE constructs, the gRNA and tCas9-VP64 expression plasmid or an empty plasmid as a negative control was quantified after 24 hours of illumination or incubation in the dark.


Figure 8: Activation capability of LACE system
using gRNA-F1 plasmid and tCas9-CIBN plasmid in BL21.

Excitation wavelength: 488 nm, Emission wavelength: 509nm. Stationary cultures of BL21 was subcultured into fresh media and growth for 8 hours using 15mM L-arabinose at 30°C.

Conclusion

The LACE system provides a straightforward and robust optogenetic method to regulate the expression of endogenous genes using the CRISPR/tCas9 system. When co-transfected with gRNAs into E.coli that are stimulated with blue light, LACE produces a high level of transcriptional activation, in some cases, comparable to those observed with tCas9-VP64.