(Prototype team page) |
|||
(10 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
{{KoreaSonyeodul}} | {{KoreaSonyeodul}} | ||
− | <html> | + | <html lang="en"> |
+ | <head> | ||
+ | <style> | ||
+ | #wrap {width: 60%; margin: auto;} | ||
+ | body{ | ||
+ | margin: 0; | ||
+ | background: url('https://static.igem.org/mediawiki/2016/e/ee/T--KoreaSonyeodul--TitleBackground.png'); | ||
+ | background-size: 100%; | ||
+ | background-repeat: no-repeat; | ||
+ | background-attachment: top; | ||
+ | } | ||
+ | <!--mainTitle--> | ||
+ | .site .mainBox .mainBox1 {width: 1000px; margin-left: auto; margin-right: auto;} | ||
+ | .site {width: 100%} | ||
+ | .site h1 { | ||
+ | margin-top: 15%; | ||
+ | color: #ffffff; | ||
+ | text-decoration: none; | ||
+ | font-size: 800%; | ||
+ | height: 35px; <!--error--> | ||
+ | background-color: rgba(255, 255, 255, 0.0);} | ||
+ | .site h2 {margin-top: 0; position: relative; margin-bottom: 300px; padding-bottom: 100px; | ||
+ | font-size: 300%; | ||
+ | color: #ffffff; | ||
+ | font-weight: 100; | ||
+ | height: 30px;<!--error--> | ||
+ | } | ||
+ | table {text-align: center;} | ||
+ | .site .mainBox .mainBox1 {width: 1000px; margin-left: auto; margin-right: auto;} | ||
+ | <!--FadeIn--> | ||
+ | @import url(http://fonts.googleapis.com/css?family=Open+Sans+Condensed:300); | ||
+ | body {padding: 0; margin: 0; background-color: #333;} | ||
+ | .container {position: fixed; top: 25%; left: 25%;} | ||
+ | @-webkit-keyframes fadeIn { from { opacity:0; } to { opacity:1; } } | ||
+ | @-moz-keyframes fadeIn { from { opacity:0; } to { opacity:1; } } | ||
+ | @keyframes fadeIn { from { opacity:0; } to { opacity:1; } } | ||
+ | .fade-in { | ||
+ | opacity:0; /* make things invisible upon start */ | ||
+ | -webkit-animation:fadeIn ease-in 1; | ||
+ | -moz-animation:fadeIn ease-in 1; | ||
+ | animation:fadeIn ease-in 1; | ||
− | + | -webkit-animation-fill-mode:forwards; | |
+ | -moz-animation-fill-mode:forwards; | ||
+ | animation-fill-mode:forwards; | ||
+ | -webkit-animation-duration:1s; | ||
+ | -moz-animation-duration:1s; | ||
+ | animation-duration:1s; | ||
+ | } | ||
− | + | .fade-in.one { | |
− | + | -webkit-animation-delay: 0.7s; | |
+ | -moz-animation-delay: 0.7s; | ||
+ | animation-delay: 0.7s; | ||
+ | } | ||
+ | .fade-in.two { | ||
+ | -webkit-animation-delay: 1.2s; | ||
+ | -moz-animation-delay:1.2s; | ||
+ | animation-delay: 1.2s; | ||
+ | } | ||
− | </ | + | .fade-in.three { |
+ | -webkit-animation-delay: 1.6s; | ||
+ | -moz-animation-delay: 1.6s; | ||
+ | animation-delay: 1.6s; | ||
+ | } | ||
+ | .content1 {word-break:break-all;} | ||
+ | .content1 h2{ font-weight: bold; | ||
+ | font-size: 30px; | ||
+ | line-height: 1.3em; | ||
+ | } | ||
+ | .content1 h3{ font-weight: normal; | ||
+ | font-size: 25px; | ||
+ | line-height: 1.3em; | ||
+ | } | ||
+ | </style> | ||
+ | <link href="http://netdna.bootstrapcdn.com/font-awesome/4.2.0/css/font-awesome.css" rel="stylesheet"></link> | ||
+ | <link href="https://fonts.googleapis.com/css?family=Roboto:100,300" rel="stylesheet"> | ||
+ | <meta name= "viewport" content = "initial-scale=1.0, width= device-width" /> | ||
+ | </link> | ||
+ | </head> | ||
+ | <body> | ||
+ | <!--Title--> | ||
+ | <div class="box fade-in one"> | ||
+ | <div id="" align="center"> | ||
+ | <div id="fontlight" class="site"> | ||
+ | <h1> | ||
+ | <font face="Roboto" weight="200">Parts</font> | ||
+ | </h1> | ||
+ | <h2> | ||
+ | <font face="Roboto">Design of the Project</font> | ||
+ | </h2> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
− | < | + | <!--TitleBoxes--> |
− | <div | + | <div id="wrap"> |
− | < | + | <div class="box fade-in two"> |
− | + | <div class="content1"> | |
− | + | <h2>Part name</h2> <h3>BBa_K1999000 (PETase)</h3> | |
− | + | <h2>Part type</h2> <h3>Protein coding sequence</h3> | |
− | + | <h2>Creator</h2> <h3>Seung-Woo Baek</h3> | |
− | + | <h2>Sequence</h2> | |
− | + | <h3>ATGAACTTTCCTCGCGCCTCCCGCTTGATGCAAGCAGCAGTCCTGGGAGGTTTAATGGCGGTCAGCGCTGCGGCGACGGCACAGACGAATCCTTACGCTCGTGGTCCAAACCCGACGGCAGCCAGTTTGGAAGCATCGGCTGGGCCTTTCACTGTCCGCAGCTTTACTGTTTCCCGCCCCTCTGGATATGGCGCAGGGACTGTCTATTACCCGACCAACGCGGGGGGCACGGTAGGAGCTATTGCAATCGTCCCCGGATACACTGCACGTCAGTCATCCATCAAGTGGTGGGGACCTCGTTTGGCCAGTCACGGTTTTGTCGTGATTACCATTGACACCAACTCAACCTTGGATCAGCCGAGCTCCCGTTCAAGTCAACAGATGGCCGCGTTGCGTCAGGTAGCCAGCCTGAACGGCACGAGCAGTTCACCTATCTATGGCAAAGTGGACACCGCGCGCATGGGAGTCATGGGCTGGTCTATGGGCGGGGGTGGAAGTCTGATTAGCGCGGCGAATAACCCCAGCTTAAAGGCAGCTGCGCCTCAAGCCCCTTGGGACTCGTCCACGAATTTCTCTTCTGTCACCGTACCCACCCTTATTTTTGCTTGCGAAAATGATTCCATCGCCCCGGTAAATTCATCGGCGTTACCAATTTATGACTCGATGAGCCGCAACGCCAAGCAATTCCTGGAGATTAATGGGGGGAGTCATTCGTGTGCAAATAGTGGAAACTCCAACCAGGCATTAATCGGCAAAAAGGGGGTAGCTTGGATGAAGCGTTTCATGGACAACGACACGCGTTACTCAACTTTCGCCTGTGAAAACCCAAATTCCACGCGCGTAAGCGATTTCCGTACCGCAAATTGCTCCTAA</h3> | |
− | + | <h2>Short description</h2> | |
− | <div class=" | + | <h3>Forms PETase which degrades PET.</h3> |
− | + | <h2>Long description</h2> | |
− | < | + | <h3>Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro</h3> |
− | + | ||
− | + | ||
− | < | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | < | + | |
− | + | ||
− | < | + | |
− | < | + | |
− | < | + | |
− | + | ||
− | < | + | |
− | < | + | |
− | < | + | |
− | < | + | |
− | < | + | |
− | < | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | <!--OtherTitleBoxes--> | ||
+ | <div class="box fade-in three"> | ||
+ | </div> | ||
+ | <!--EndOfWrap--> | ||
+ | <!--Footer--> | ||
+ | </body> | ||
</html> | </html> |
Latest revision as of 06:12, 16 October 2016