Difference between revisions of "Team:KoreaSonyeodul/Parts"

(Prototype team page)
 
 
(10 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
{{KoreaSonyeodul}}
 
{{KoreaSonyeodul}}
−
<html>
+
<html lang="en">
 +
  <head>
 +
    <style>
 +
      #wrap {width: 60%; margin: auto;}
 +
      body{
 +
      margin: 0;
 +
      background: url('https://static.igem.org/mediawiki/2016/e/ee/T--KoreaSonyeodul--TitleBackground.png');
 +
      background-size: 100%;
 +
      background-repeat: no-repeat;
 +
      background-attachment: top;
 +
      }
 +
      <!--mainTitle-->
 +
      .site .mainBox .mainBox1 {width: 1000px; margin-left: auto; margin-right: auto;}
 +
      .site {width: 100%}
 +
      .site h1 {
 +
      margin-top: 15%;
 +
      color: #ffffff;
 +
      text-decoration: none;
 +
      font-size: 800%;
 +
      height: 35px; <!--error-->
 +
      background-color: rgba(255, 255, 255, 0.0);}
 +
      .site h2 {margin-top: 0; position: relative; margin-bottom: 300px; padding-bottom: 100px;
 +
      font-size: 300%;
 +
      color: #ffffff;
 +
font-weight: 100;
 +
      height: 30px;<!--error-->
 +
      }
 +
      table {text-align: center;}
 +
      .site .mainBox .mainBox1 {width: 1000px; margin-left: auto; margin-right: auto;}
  
 +
      <!--FadeIn-->
 +
      @import url(http://fonts.googleapis.com/css?family=Open+Sans+Condensed:300);
  
 +
      body {padding: 0; margin: 0; background-color: #333;}
  
 +
      .container {position: fixed; top: 25%; left: 25%;}
  
 +
      @-webkit-keyframes fadeIn { from { opacity:0; } to { opacity:1; } }
 +
      @-moz-keyframes fadeIn { from { opacity:0; } to { opacity:1; } }
 +
      @keyframes fadeIn { from { opacity:0; } to { opacity:1; } }
  
 +
      .fade-in {
 +
      opacity:0;  /* make things invisible upon start */
 +
      -webkit-animation:fadeIn ease-in 1;
 +
      -moz-animation:fadeIn ease-in 1;
 +
      animation:fadeIn ease-in 1;
  
−
<div class="column full_size">
+
      -webkit-animation-fill-mode:forwards;
 +
      -moz-animation-fill-mode:forwards;
 +
      animation-fill-mode:forwards;
  
 +
      -webkit-animation-duration:1s;
 +
      -moz-animation-duration:1s;
 +
      animation-duration:1s;
 +
      }
  
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
      .fade-in.one {
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
      -webkit-animation-delay: 0.7s;
 +
      -moz-animation-delay: 0.7s;
 +
      animation-delay: 0.7s;
 +
      }
  
 +
      .fade-in.two {
 +
      -webkit-animation-delay: 1.2s;
 +
      -moz-animation-delay:1.2s;
 +
      animation-delay: 1.2s;
 +
      }
  
−
</div>
+
      .fade-in.three {
 +
      -webkit-animation-delay: 1.6s;
 +
      -moz-animation-delay: 1.6s;
 +
      animation-delay: 1.6s;
 +
      }
 +
.content1 {word-break:break-all;}
 +
.content1 h2{ font-weight: bold;
 +
font-size: 30px;
 +
line-height: 1.3em;
 +
}
 +
.content1 h3{ font-weight: normal;
 +
font-size: 25px;
 +
line-height: 1.3em;
 +
}
 +
    </style>
 +
    <link href="http://netdna.bootstrapcdn.com/font-awesome/4.2.0/css/font-awesome.css" rel="stylesheet"></link>
 +
    <link href="https://fonts.googleapis.com/css?family=Roboto:100,300" rel="stylesheet">
 +
      <meta name= "viewport" content = "initial-scale=1.0, width= device-width" />
 +
    </link>
 +
  </head>
  
 +
  <body>
  
 +
    <!--Title-->
  
 +
    <div class="box fade-in one">
 +
      <div id="" align="center">
 +
        <div id="fontlight" class="site">
 +
          <h1>
 +
            <font face="Roboto" weight="200">Parts</font>
 +
          </h1>
 +
          <h2>
 +
            <font face="Roboto">Design of the Project</font>
 +
          </h2>
 +
        </div>
 +
      </div>
 +
    </div>
  
  
−
<div class="column half_size">
+
    <!--TitleBoxes-->
−
<div class="highlight">
+
    <div id="wrap">
−
<h5>Note</h5>
+
      <div class="box fade-in two">
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
        <div class="content1">
−
</div>
+
<h2>Part name</h2> <h3>BBa_K1999000 (PETase)</h3>
−
</div>
+
<h2>Part type</h2> <h3>Protein coding sequence</h3>
−
 
+
<h2>Creator</h2> <h3>Seung-Woo Baek</h3>
−
 
+
<h2>Sequence</h2>
−
 
+
<h3>ATGAACTTTCCTCGCGCCTCCCGCTTGATGCAAGCAGCAGTCCTGGGAGGTTTAATGGCGGTCAGCGCTGCGGCGACGGCACAGACGAATCCTTACGCTCGTGGTCCAAACCCGACGGCAGCCAGTTTGGAAGCATCGGCTGGGCCTTTCACTGTCCGCAGCTTTACTGTTTCCCGCCCCTCTGGATATGGCGCAGGGACTGTCTATTACCCGACCAACGCGGGGGGCACGGTAGGAGCTATTGCAATCGTCCCCGGATACACTGCACGTCAGTCATCCATCAAGTGGTGGGGACCTCGTTTGGCCAGTCACGGTTTTGTCGTGATTACCATTGACACCAACTCAACCTTGGATCAGCCGAGCTCCCGTTCAAGTCAACAGATGGCCGCGTTGCGTCAGGTAGCCAGCCTGAACGGCACGAGCAGTTCACCTATCTATGGCAAAGTGGACACCGCGCGCATGGGAGTCATGGGCTGGTCTATGGGCGGGGGTGGAAGTCTGATTAGCGCGGCGAATAACCCCAGCTTAAAGGCAGCTGCGCCTCAAGCCCCTTGGGACTCGTCCACGAATTTCTCTTCTGTCACCGTACCCACCCTTATTTTTGCTTGCGAAAATGATTCCATCGCCCCGGTAAATTCATCGGCGTTACCAATTTATGACTCGATGAGCCGCAACGCCAAGCAATTCCTGGAGATTAATGGGGGGAGTCATTCGTGTGCAAATAGTGGAAACTCCAACCAGGCATTAATCGGCAAAAAGGGGGTAGCTTGGATGAAGCGTTTCATGGACAACGACACGCGTTACTCAACTTTCGCCTGTGAAAACCCAAATTCCACGCGCGTAAGCGATTTCCGTACCGCAAATTGCTCCTAA</h3>
−
 
+
<h2>Short description</h2>
−
<div class="column half_size">
+
<h3>Forms PETase which degrades PET.</h3>
−
 
+
<h2>Long description</h2>
−
<h5>Adding parts to the registry</h5>
+
<h3>Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro</h3>
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
+
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
 
+
−
 
+
−
<div class="column half_size">
+
−
 
+
−
<h5>What information do I need to start putting my parts on the Registry?</h5>
+
−
<p>The information needed to initially create a part on the Registry is:</p>
+
−
<ul>
+
−
<li>Part Name</li>
+
−
<li>Part type</li>
+
−
<li>Creator</li>
+
−
<li>Sequence</li>
+
−
<li>Short Description (60 characters on what the DNA does)</li>
+
−
<li>Long Description (Longer description of what the DNA does)</li>
+
−
<li>Design considerations</li>
+
−
</ul>
+
−
 
+
−
<p>
+
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
+
−
 
+
−
</div>
+
−
 
+
−
 
+
−
<div class="column half_size">
+
−
 
+
−
<h5>Inspiration</h5>
+
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
−
 
+
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
+
−
<ul>
+
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
+
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
+
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
+
−
</ul>
+
−
</div>
+
−
 
+
−
<div class="column full_size">
+
−
<h5>Part Table </h5>
+
−
<div class="highlight">
+
−
 
+
−
 
+
−
</html>
+
−
<groupparts>iGEM2016 Example</groupparts>
+
−
<html>
+
−
</div>
+
 
</div>
 
</div>
 +
          </div>
 +
        </div>
  
  
 +
      <!--OtherTitleBoxes-->
 +
      <div class="box fade-in three">
  
 +
      </div>
 +
      <!--EndOfWrap-->
 +
      <!--Footer-->
  
 +
    </body>
 
</html>
 
</html>

Latest revision as of 06:12, 16 October 2016

Parts

Design of the Project

Part name

BBa_K1999000 (PETase)

Part type

Protein coding sequence

Creator

Seung-Woo Baek

Sequence

ATGAACTTTCCTCGCGCCTCCCGCTTGATGCAAGCAGCAGTCCTGGGAGGTTTAATGGCGGTCAGCGCTGCGGCGACGGCACAGACGAATCCTTACGCTCGTGGTCCAAACCCGACGGCAGCCAGTTTGGAAGCATCGGCTGGGCCTTTCACTGTCCGCAGCTTTACTGTTTCCCGCCCCTCTGGATATGGCGCAGGGACTGTCTATTACCCGACCAACGCGGGGGGCACGGTAGGAGCTATTGCAATCGTCCCCGGATACACTGCACGTCAGTCATCCATCAAGTGGTGGGGACCTCGTTTGGCCAGTCACGGTTTTGTCGTGATTACCATTGACACCAACTCAACCTTGGATCAGCCGAGCTCCCGTTCAAGTCAACAGATGGCCGCGTTGCGTCAGGTAGCCAGCCTGAACGGCACGAGCAGTTCACCTATCTATGGCAAAGTGGACACCGCGCGCATGGGAGTCATGGGCTGGTCTATGGGCGGGGGTGGAAGTCTGATTAGCGCGGCGAATAACCCCAGCTTAAAGGCAGCTGCGCCTCAAGCCCCTTGGGACTCGTCCACGAATTTCTCTTCTGTCACCGTACCCACCCTTATTTTTGCTTGCGAAAATGATTCCATCGCCCCGGTAAATTCATCGGCGTTACCAATTTATGACTCGATGAGCCGCAACGCCAAGCAATTCCTGGAGATTAATGGGGGGAGTCATTCGTGTGCAAATAGTGGAAACTCCAACCAGGCATTAATCGGCAAAAAGGGGGTAGCTTGGATGAAGCGTTTCATGGACAACGACACGCGTTACTCAACTTTCGCCTGTGAAAACCCAAATTCCACGCGCGTAAGCGATTTCCGTACCGCAAATTGCTCCTAA

Short description

Forms PETase which degrades PET.

Long description

Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro