Difference between revisions of "Team:KoreaSonyeodul/Parts"

 
(7 intermediate revisions by the same user not shown)
Line 73: Line 73:
 
       animation-delay: 1.6s;
 
       animation-delay: 1.6s;
 
       }
 
       }
.content1 h2{ font-weight: normal;
+
.content1 {word-break:break-all;}
font-size: 25px;
+
.content1 h2{ font-weight: bold;
 +
font-size: 30px;
 
line-height: 1.3em;
 
line-height: 1.3em;
 
}
 
}
 
.content1 h3{ font-weight: normal;
 
.content1 h3{ font-weight: normal;
font-size: 20px;
+
font-size: 25px;
 
line-height: 1.3em;
 
line-height: 1.3em;
 
}
 
}
Line 119: Line 120:
 
<h2>Long description</h2>
 
<h2>Long description</h2>
 
<h3>Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro</h3>
 
<h3>Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro</h3>
 
+
</div>
 
           </div>
 
           </div>
 
         </div>
 
         </div>

Latest revision as of 06:12, 16 October 2016

Parts

Design of the Project

Part name

BBa_K1999000 (PETase)

Part type

Protein coding sequence

Creator

Seung-Woo Baek

Sequence

ATGAACTTTCCTCGCGCCTCCCGCTTGATGCAAGCAGCAGTCCTGGGAGGTTTAATGGCGGTCAGCGCTGCGGCGACGGCACAGACGAATCCTTACGCTCGTGGTCCAAACCCGACGGCAGCCAGTTTGGAAGCATCGGCTGGGCCTTTCACTGTCCGCAGCTTTACTGTTTCCCGCCCCTCTGGATATGGCGCAGGGACTGTCTATTACCCGACCAACGCGGGGGGCACGGTAGGAGCTATTGCAATCGTCCCCGGATACACTGCACGTCAGTCATCCATCAAGTGGTGGGGACCTCGTTTGGCCAGTCACGGTTTTGTCGTGATTACCATTGACACCAACTCAACCTTGGATCAGCCGAGCTCCCGTTCAAGTCAACAGATGGCCGCGTTGCGTCAGGTAGCCAGCCTGAACGGCACGAGCAGTTCACCTATCTATGGCAAAGTGGACACCGCGCGCATGGGAGTCATGGGCTGGTCTATGGGCGGGGGTGGAAGTCTGATTAGCGCGGCGAATAACCCCAGCTTAAAGGCAGCTGCGCCTCAAGCCCCTTGGGACTCGTCCACGAATTTCTCTTCTGTCACCGTACCCACCCTTATTTTTGCTTGCGAAAATGATTCCATCGCCCCGGTAAATTCATCGGCGTTACCAATTTATGACTCGATGAGCCGCAACGCCAAGCAATTCCTGGAGATTAATGGGGGGAGTCATTCGTGTGCAAATAGTGGAAACTCCAACCAGGCATTAATCGGCAAAAAGGGGGTAGCTTGGATGAAGCGTTTCATGGACAACGACACGCGTTACTCAACTTTCGCCTGTGAAAACCCAAATTCCACGCGCGTAAGCGATTTCCGTACCGCAAATTGCTCCTAA

Short description

Forms PETase which degrades PET.

Long description

Involved in the degradation and assimilation of the plastic poly(ethylene terephthalate) (PET), which allows I.sakaiensis to use PET as its major energy and carbon source for growth. Catalyzes the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Is also able to hydrolyze bis(hydroxyethyl) terephthalate (BHET) to yield MHET with no further decomposition. Shows low activity towards p-nitrophenol-linked aliphatic esters (pNP-aliphatic esters) in vitro