Difference between revisions of "Team:NAU-CHINA/Experiment/CAT"

(Created page with "<html> <head> <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"> <meta name="viewport" content="width=device-width,initial-scale=1...")
 
 
(6 intermediate revisions by the same user not shown)
Line 121: Line 121:
 
             }
 
             }
  
 
+
#maintext a:hover{
 +
color:#0096ff;
 +
text-decoration: none;
 +
}
 +
#maintext a{
 +
color: blue;
 +
text-decoration: none;
 +
}
 
#maintext .imgbox{
 
#maintext .imgbox{
 
text-align: center;
 
text-align: center;
Line 147: Line 154:
 
#ClickBack img{
 
#ClickBack img{
 
width: 100px;
 
width: 100px;
 +
}
 +
#maintext #table01{
 +
margin-left:35%;
 +
text-align: center;
 +
}
 +
#maintext #table02{
 +
margin-left: 35%;
 +
text-align: center;
 
}
 
}
 
</style>
 
</style>
Line 262: Line 277:
 
<div>
 
<div>
 
<br><br>
 
<br><br>
 +
<h1>Verification of the function of catechol 2,3-dioxygenase from YBL2</h1>
 
<h1>Background</h1>
 
<h1>Background</h1>
 
<p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p>
 
<p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p>
Line 278: Line 294:
 
<p><b>Fig.2</b></p>
 
<p><b>Fig.2</b></p>
 
</div>
 
</div>
 +
<div id="table01">
 
<p>PCR System(15µL):</p>
 
<p>PCR System(15µL):</p>
 
<table>
 
<table>
Line 302: Line 319:
 
</table>
 
</table>
 
<p>Total time: 1h49min</p>
 
<p>Total time: 1h49min</p>
 +
</div>
 
<div class="imgbox">
 
<div class="imgbox">
 
<img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png">
 
<img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png">
 
<p><b>Fig.3</b></p>
 
<p><b>Fig.3</b></p>
 
</div>
 
</div>
 +
<div id="table02">
 
<p>PCR System(50µL):</p>
 
<p>PCR System(50µL):</p>
 
<table>
 
<table>
Line 324: Line 343:
 
<td>25µL</td>
 
<td>25µL</td>
 
</tr>
 
</tr>
 +
 
</table>
 
</table>
 +
<p>Total time: 48min</p>
 +
</div>
 
<div class="imgbox">
 
<div class="imgbox">
 
<img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png">
 
<img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png">
 
<p><b>Fig.4</b></p>
 
<p><b>Fig.4</b></p>
 +
 
</div>
 
</div>
<p>Total time: 48min</p>
+
 
<h1>Construction of Recombinant Expression Vector</h1>
 
<h1>Construction of Recombinant Expression Vector</h1>
 
<div class="imgbox">
 
<div class="imgbox">
Line 350: Line 373:
 
<p><b>Fig.7</b></p>
 
<p><b>Fig.7</b></p>
 
</div>
 
</div>
+
<p><a href="http://parts.igem.org/Part:BBa_J33204:Experience">BBa_J33204:Experience</a></p>
 +
<p>We also used BBa_J33204 to construct a device and demonstrated that it worked out well. </p>
 +
<p>BBa_J33204 includes the xylE gene .This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which also converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde.</p>
 
</div>
 
</div>
 
</div>
 
</div>

Latest revision as of 20:18, 19 October 2016



Verification of the function of catechol 2,3-dioxygenase from YBL2

Background

Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.

Fig.1

Bacterial Strain

Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days.

Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS

Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG

Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC

Fig.2

PCR System(15µL):

template single colonies
ddH2O 6.9ul
Primer 0.5ul
MixEx TaqTM Version 7.5ul
2.0 plus dye

Total time: 1h49min

Fig.3

PCR System(50µL):

template single colonies/bacteria liquid (2µL)
ddH2O 23µL or 21µL
Primer 2µL
MixPrime STAR 25µL

Total time: 48min

Fig.4

Construction of Recombinant Expression Vector

Fig.5

Functional Verification

Method

Step one: Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.

Step two: Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.

*Note that the catechol solution should be kept away from light and air.

The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.

*pbaC as negative control (CK).

Fig.6

Fig.7

BBa_J33204:Experience

We also used BBa_J33204 to construct a device and demonstrated that it worked out well.

BBa_J33204 includes the xylE gene .This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which also converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde.