(Created page with "<html> <head> <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"> <meta name="viewport" content="width=device-width,initial-scale=1...") |
|||
(6 intermediate revisions by the same user not shown) | |||
Line 121: | Line 121: | ||
} | } | ||
− | + | #maintext a:hover{ | |
+ | color:#0096ff; | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | #maintext a{ | ||
+ | color: blue; | ||
+ | text-decoration: none; | ||
+ | } | ||
#maintext .imgbox{ | #maintext .imgbox{ | ||
text-align: center; | text-align: center; | ||
Line 147: | Line 154: | ||
#ClickBack img{ | #ClickBack img{ | ||
width: 100px; | width: 100px; | ||
+ | } | ||
+ | #maintext #table01{ | ||
+ | margin-left:35%; | ||
+ | text-align: center; | ||
+ | } | ||
+ | #maintext #table02{ | ||
+ | margin-left: 35%; | ||
+ | text-align: center; | ||
} | } | ||
</style> | </style> | ||
Line 262: | Line 277: | ||
<div> | <div> | ||
<br><br> | <br><br> | ||
+ | <h1>Verification of the function of catechol 2,3-dioxygenase from YBL2</h1> | ||
<h1>Background</h1> | <h1>Background</h1> | ||
<p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p> | <p>Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.</p> | ||
Line 278: | Line 294: | ||
<p><b>Fig.2</b></p> | <p><b>Fig.2</b></p> | ||
</div> | </div> | ||
+ | <div id="table01"> | ||
<p>PCR System(15µL):</p> | <p>PCR System(15µL):</p> | ||
<table> | <table> | ||
Line 302: | Line 319: | ||
</table> | </table> | ||
<p>Total time: 1h49min</p> | <p>Total time: 1h49min</p> | ||
+ | </div> | ||
<div class="imgbox"> | <div class="imgbox"> | ||
<img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png"> | <img src="https://static.igem.org/mediawiki/2016/5/55/T--NAU-CHINA--EX_C23O03.png"> | ||
<p><b>Fig.3</b></p> | <p><b>Fig.3</b></p> | ||
</div> | </div> | ||
+ | <div id="table02"> | ||
<p>PCR System(50µL):</p> | <p>PCR System(50µL):</p> | ||
<table> | <table> | ||
Line 324: | Line 343: | ||
<td>25µL</td> | <td>25µL</td> | ||
</tr> | </tr> | ||
+ | |||
</table> | </table> | ||
+ | <p>Total time: 48min</p> | ||
+ | </div> | ||
<div class="imgbox"> | <div class="imgbox"> | ||
<img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png"> | <img src="https://static.igem.org/mediawiki/2016/a/a5/T--NAU-CHINA--EX_C23O04.png"> | ||
<p><b>Fig.4</b></p> | <p><b>Fig.4</b></p> | ||
+ | |||
</div> | </div> | ||
− | + | ||
<h1>Construction of Recombinant Expression Vector</h1> | <h1>Construction of Recombinant Expression Vector</h1> | ||
<div class="imgbox"> | <div class="imgbox"> | ||
Line 350: | Line 373: | ||
<p><b>Fig.7</b></p> | <p><b>Fig.7</b></p> | ||
</div> | </div> | ||
− | + | <p><a href="http://parts.igem.org/Part:BBa_J33204:Experience">BBa_J33204:Experience</a></p> | |
+ | <p>We also used BBa_J33204 to construct a device and demonstrated that it worked out well. </p> | ||
+ | <p>BBa_J33204 includes the xylE gene .This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which also converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde.</p> | ||
</div> | </div> | ||
</div> | </div> |
Latest revision as of 20:18, 19 October 2016
Verification of the function of catechol 2,3-dioxygenase from YBL2
Background
Catechol is a toxic organic metabolite found in the degradation of pesticide. Catechol 2,3-dioxygenase can rapidly convert catechol into 2-hydroxymuconic semialdehyde (2-HMS). 2-HMS is a non-toxic, bright yellow molecule that can be metalbolized by E.coli DH5α.
Fig.1
Bacterial Strain
Strain Sphingomonads sp.YBL2 was cultured on LB medium with streptomycin(100mg/L) at 30℃ for 2 days.
Cloning of catechol 2,3-dioxygenase(C23O) gene with native RBS
Primer: Forward primer: GAATTCGCGGCCGCTTCTAGAGGCTGCCTGAACAAGACTGAG
Reverse primer: CTGCAGCGGCCGCTACTAGTAACGCCACAGGTTTAGAAGC
Fig.2
PCR System(15µL):
template | single colonies |
ddH2O | 6.9ul |
Primer | 0.5ul |
MixEx TaqTM Version | 7.5ul |
2.0 plus dye |
Total time: 1h49min
Fig.3
PCR System(50µL):
template | single colonies/bacteria liquid (2µL) |
ddH2O | 23µL or 21µL |
Primer | 2µL |
MixPrime STAR | 25µL |
Total time: 48min
Fig.4
Construction of Recombinant Expression Vector
Fig.5
Functional Verification
Method
Step one: Transformed the vector into E.coli (DH5α) and streaked it on LB agar with chloramphenicol.
Step two: Dripped 100μL 0.2mol/L catechol onto the colonies, and placed at 37℃ for 10 minutes.
*Note that the catechol solution should be kept away from light and air.
The picture below shows the plate before and after dripping catechol solution. It indicated that 2-HMS was produced by C23O.
*pbaC as negative control (CK).
Fig.6
Fig.7
We also used BBa_J33204 to construct a device and demonstrated that it worked out well.
BBa_J33204 includes the xylE gene .This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which also converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde.