Cultured cells from former SB-iGEM team's plate with melanin-producing cells (Andy Weir-signed plate)

Cells were dead -- need to pivot and find new way to produce melanin

Julia's old lab has melanocytes that overexpress melanin

Copper and tyrosine supplemented to growth media boosted pigmentation of melanin

Cambridge team from registry has version of MelA Tyrosinase necessary (Eumelanin superior to pheomelanin and neuromelanin)

Coating with Titanium Dioxide to produce a solar cell still an idea down the road

This biobrick already contained one substituted nucleotide (C to T at the 1000th nucleotide) resulting in a Pro₃₃₄ to Ser mutation that was shown to decrease time to onset of melanin production (Santos et al. 2008)

Changed Asp₅₃₅ to Gly by substituting a single nucleotide --> this mutation was also shown in a more recent paper to shorten the time to onset of melanin production in E. coli (Chávez-Béjar et al. 2013)

Began designing primers to insert mutMelA into pSB1C3 backbone with appropriate promoters and RBS

Continued research on small melanin binding proteins

Many short polypeptides shown to be effective in binding melanin, linked to a radioactive subunit and tested in vitro and in vivo (in mice) for human melanoma cell localization and radiation delivery

One decapeptide discovered through the use of a phage display library called 4B4 shown to be effective at binding melanin (Ballard et al. 2011)

Many phage display library derived heptapeptides shown to be effective (Howell et al. 2007)

Discussed possibility of designing CBD-Melanin-Binding Peptide connector

ELIAS'S LAB NOTEBOOK

Ordered MelA gene from iGEM registry

Next: design plasmid with inducible promoter

Next: Order primers for linearisation and Gibson

Melanin binding peptides:

4B4: Fungal melanin-binding decapeptide

Sequence: YERKFWHGRH

Designed oligonucleotide sequences for repetetive sequence assembly (Kosuke's method)

Planning on assembling as follows:

Should also order & assemble irrelevant decapeptide PA1 as control

Sequence: LQYTPSWMLV

Set of heptapeptides: (Howel 2007)

Phage 4D had highest melanised/non-melanised absorbance ratio, expressed peptide

His-Thr-Thr-His-His-Arg-Asn

HTTHHRN

Phage 3D: Asn-Pro-Asn-Trp-Gly-Pro-Arg (NPNWGPR)

Phage 1C: Thr-Thr-His-Gln-Phe-Pro-Phe (TTHQFPF)

Irrelevant control: Asp-Gly-Ala-Trp-Met-Gly-Ala (DGAWMGA)

Optimising melanin production in E. coli

Cultivation media & growth conditions

Melanin producing cell media

50ml per culture of...

M9 minimal salts medium

Supplemented with 2 or 10 g/L glucose

0.1 mM IPTG

Required antibiotic (strain-specific)

0.4 g/L of L-tyrosine

20 ug/mL

Decided to engineer a repetitive motif of the melanin binding decapeptide 4B4 as well as the most effective melanin binding heptapeptide documented in Howell et al. 2007 (will be refered to as 4D based on cell strain in paper).

Based on the sizes of the genes that would code for the two candidate polypeptides (30mer and 21mer), we decided to use the methods detailed in Fujishima et al 2015 for overhang based randomized DNA block assembly

Decided to attach melanin binding repetitive motif to cellulose binding domain

Plan on demonstrating proof of concept for all in one melanin binding/membrane binding linker to be used as a mechanism for even and resiliant melanin coating to increase UV radiation resistance

Constructed 45mer GS linker in silico to separate and preserve the functions of the CBD and the melanin binding domain

Designed single stranded oligonucleotides for DNA building blocks of 4B4 and 4D, as well as non-melanin binding control decapeptide PA1 and heptapeptide P601G from Ballard et al. 2011 and Howell et al. 2007 respectively

Designed full plasmid construct for melanin binding repetitive motif connected at its C-terminus by a 45mer GS linker to the cellulose binding domain in Biobrick BBa_K1321357, which is followed by a FLAG-lumio-HIS tag for purification, and finally a double terminator

Decided to linearize pSB1C3 backbone from meffRed BBa_K1033920, including BBa_J23110 constitutive promoter, Elowitz Represilator RBS BBa_B0034, and meffRed start codon since no start codon was included in repetitive melanin binding DNA block

Began designing primers for linearization of plasmid backbone and PCR amplification of biobricked CBD

Used SnapGene Gibson Assembly software for primer design

Included primer tail extensions to create identical overlaps with fragment inserts for later Gibson assembly

Ran into issues with inconsistent Tm values due to high GC content, as well as secondary annealing sites due to redundancies in pSB1C3 prefix and suffix

ELIAS'S LAB NOTEBOOK

Assembly of Kosuke fragments:

Needed enzymes:

T4 DNA ligase (NEB)

Cat #: M0202S (400,000 units/ml)

Cat #: M0202T (2,000,000 units/ml)

Size: 20,000 units

Cost: $64

T4 polynucleotide kinase (NEB)

Cat #: M0201S (500 units), $56

Cat #: M0201L (2,500 units), $224

Concentration: 10,000 units/ml (price: $224)

ELIM sequencing preparation:

Premix recipe:

Total volume: 15ul (in water)

Template quantity:

PCR products:

100-200bp

200-500bp --> 2-3ng

500-1000bp --> 6-8ng

1000-2000bp --> 10-15ng

>=2000bp --> 60-100ng

Single stranded: 100-150ng

Double stranded (plasmids): 500ng

Primer: 8pmol

Upregulate carbon flow to aromatic/L-tyrosine

Got cells with genomic deletions for shuttling carbon into L-tyrosine/aromatics pathway

Obtained melanocytes from Julia's former lab at VA Hospital and lysed in water to obtain melanin raw source

Ordered ten single stranded oligonucleotides from ELIM

Top and bottom strands for 4B4, 4D, PA1, P601G, and GS linker

Designed so that once annealed, each double stranded oligo would have a six nucleotide double Gly overhang for assembly and ligation

Continued designing PCR primers for linearization of intended backbone and amplification of CBD for Gibson assembly

Secondary annealing site issues solved by using NEBuilder online software for primer design: created longer primary annealing regions on primers and increased initial Tm so that secondary annealing would be outweighed by correct annealing of primers

ELIAS'S NOTEBOOK

Fri 7/23: anneal oligos

Mon 7/26: Phosphorylate & ligate

Tues 7/27: run gel and extract correct band

DNA annealing:

Template:

Oligo forward (200uM) - 10ul

Oligo reverse (200uM) - 10ul

10x H Buffer - 2ul

DI H2O - 28ul

Total - 50ul

Final oligo concentration: 80mM

Mixed 4B4, 4D, PA1, P6016 in above formula

Ran in thermal cycler on "anneal" in Kosuke's folder

Let sit at 4˚C for 15 min then put in -20˚C

All oligos in orange iGEM 2016 box in -20˚C

Kosuke's paper: "an overhand-based ... random library" (2015)

Paper suggests annealing of oligos in thermal cycler by decreasing 10˚C every 5 minutes (we used 1-2 minutes)

Phosphorylation: used T4 kinase in 10x ligase buffer at 37˚C for 1h

Ligation: T4 DNA ligase added directly to above mix, incubated at room temperature for 2h

Adapter (blunt ends): phosphorylated, then mixed with phosphorylated DNA blocks in 1:8:1 ratio in 1x T4 DNA ligase buffer (5' adapter : DNA block : 3' adapter)

Can also incubate at 16˚C overnight to increase efficiency

Eight of the oligos arrived (everything but the GS linker)

Annealed oligos using the "Annealing of Template DNA" protocol

Stored in -20°C fridge for repetitive assembly upon arrival of GS linker

Prepared and assembled buffers and enzymes for overnight phosphorylation and ligation of repetitive DNA building blocks following "Phosphorylation and Ligation of Repetitive DNA Building Blocks"

Used T4 Polynucleotide Kinase and T4 DNA Ligase

Awaiting arrival of blunt ended GS linker for construction of repetitive motif

No oligos came, will wait until Monday for reaction

ELIAS'S LAB NOTEBOOK

ELIM: melanin binding constructu linker arrived

Annealed single stranded oligos

Ready for Kosuke's repetitive DNA block assembly

Small repetitive fragment assembly:

6 PCR tubes:

*7 PCR tubes (2 runs of linker, used H buffer that was not entirely thawed for first)

Used protocol taped to next page

Let ligation mixes sit at 16˚C overnight

Started thermal cycler at 5:40pm

ELIM orders #234915

Ordered 9 single-stranded oligos

Melanin: primers for assembly of plasmid using CBD from BBa_K1321357 and FLAG-lumio-His tag

Removed previous day's ligation mixes from thermal cycler and put in -20˚C at 9:30am

Realised no linker was pit in DNA assembled block mixes --> will re-phosphorylate and ligate overnight

Running gel to test concentratin of loaded DNA to concentration of gel extracted bands

Lost gel --> no extraction

ELIM primers:

Ran PCR on CBD from Cynthia --> will gel tomorrow

Reran fragments in Danny's 3% gel

100ng, 115V --> had weird tail

Kosuke assembly pt 2

Will try two different link:DNA block ratios

1:10 and 1:20 block/link mixes labelled in blue, ligations of said mixes labeled in black with a blue dot

Gel extraction calibration

Aim for 0.2pmol product

600bp --> want >30ng/ul

300bp --> want >15ng/ul

Forgot to run mixed 4B4 and 4D + link

ELIAS'S LAB NOTEBOOK

Made 3% large gel: 12 lane wide comb

1.5ul ladder

~175ng DNA per well (besides CBD)

Mixed 1ul dye + 1.2-2ul DNA + x H2O

6ul per DNA

4B4: 222ng/ul --> 1.58ul + 3.42 H2O

PA1: 1.58ul --> ""

4D: 166ng/ul --> 2.11ul + 2.89ul H2O

P601G "" --> ""

PAGE gel:

Ligation of mixes liquid cultured with meffRed E. coli from cryostock

Two 5ml liquid cultures, 37˚C ~16hrs

ELIAS'S LAB NOTEBOOK

Gel #3: melanin binding

Future gels run with a linker only

Lane --> compare to see if linker bound

Miniprepped meffRed cultures --> ~30ng/ul per

Ran PCR on miniprepped samples

4 tubes:

4B4 (50ul Q5 rxn)

4D (50ul Q5 rxn)

PA1 (25ul Q5 rxn)

P601G (25ul Q5 rxn)

Diluted ~29ng/ul miniprep product 1:40 with H2O, used 1ul per PCR tube

ELIAS'S LAB NOTEBOOK

PAGE - polyacrylamide gel electrophoresis

SDS-PAGE used for proteins (sodium dodecyl sulfide)

DNA PAGE:

Buffers and solutions:

Ammonium persulfate (10% w/v) (TEMED catalyst?)

Acrylamide:bisacrylamide (29:1) (30% w/v)

5x TBE --> run in 0.5x or 1.0x TBE

Volume of reagents:

CBD PCR round #2:

Diluted ~52ng/ul CBD template 1:60

Used 1ul in PCR mix

50ul Q5 recipe

Fridge gel:

Melanin binding gel extraction:

Plasmid backbone for 4 types of DNA blocks

1 = 4B4 - 50ul

2 = PA1 - 25ul

3 = 4D - 50ul

4 = P601G - 25ul

5 = CBD - 50ul

Gel time:

Made 1% large agarose gel - running at 90V for 2hrs

Aiming for 1ug DNA of 4B4, 4D, and mix

Used big 12-well comb --> order:

500ng/well --> 1ng for 2 wells a piece

Tried using lab tape to link adjacent wells but agar and TAE solution made tape come undone

4B4 ligated product: 222ng/ul --> 2.25ul/well + 1ul dye + 2.75ul H2O

Mix: 194ng/ul --> 2.6 ug/well + 1ul dye + 2.4ul H2O

4D: 166 ng/ul --> 3ul/well + 1ul dye + 2ul H2O

The gel that works:

1% gel, ran in fridge, 500ng/well, 90V, 2hrs

Premix to load wells with: (in PCR tubes)

4B4: 4.5ul ligation product

2ul dye

5.5ul H2O

Mix: 5.2ul ligation product

2ul dye

4.8ul H2O

4D: 5ul ligation product

2ul dye

4ul H2O

Extractions of the gel that works:

4B4A: cut from ~280-400mer

4B4B: cut from ~500mer-700mer

*Same for 4DA and 4DB, Mix A and Mix B

Expecting enough DNA from gel extractions A to perform Gibson, unsure of thos efrom B

Will perform Gibson on all 5 GEX products

Will tarnsform and plate all 6 with a 1:4 and 1:40 dilution

Nanodrop showed fairly poor concentrations

Ordered primers for Gibson Assembly of MutMelA into pSB1C3

ELIAS'S LAB NOTEBOOK

Gibson:

CBD: 73.4ng/ul --> 368bp --> 0.307pmol/ul

Lin backbones: ~2180bp

4B4: 91.6ng/ul --> 0.065pmol/ul

PA1: 51.8ng/ul --> 0.037pmol/ul

4D: 93.1ng/ul --> 0.066pmol/ul

P601G: 60.9ng/ul --> 0.043pmol/ul

Repetitive insert:

4B4Long: 1.4ng/ul

4B4Short: 4.2ng/ul

4DLong: 3.2ng/ul

4DShort: 7.7ng/ul

MixLong: 3.1ng/ul

MixShort: 4.5ng/ul

*4B4Short: ~350mer --> 0.019pmol/ul

4B4Long: ~600mer --> 0.003pmol/ul

MixShort: --> 0.020pmol/ul

NEBuilder mix:

Will only run short segments --> too dilute

2ul vector

5ul mix

1ul CBD

1ul Tag

PCR confirmation on GEX:

4DL - 4D long GEX (500-700mer)

4DS - 4D short GEX (250-400mer)

+ - positive control

4B4 - 4B4 short GEX (250-400mer)

Mix B - Mix short

Gel on PCR product (above)

Expect results in third row, weird results --> gel didn't work

Re-annealed all DNA blocks: used "anneal" protocol on thermocycler

Phosphorylation and overnight ligation

Use Kosuke's protocol for 4B4, 4D, PA1, P601G, Mix

20ul product + just link

Used 1:10 linker:DNA block ratio

Buffer MM: 6.5 x each tube --> add 15ul per tube

4B4: 4.55ul 4B4 + 0.46ul link

PA1: 4.55ul PA1 + 0.46ul link

4D: 4.55ul 4D + 0.46ul link

P601G: 4.55ul P601G + 0.46ul link

Mix: 2.27ul 4B4 + 2.27ul 4D + 0.46ul link

Link: 5ul link

PCR cleanup on ligated samples:

Running PCR cleanup on ligated samples to remove oligos from mix --> increase desired length:total DNA fragment ratio by only retaining DNA strands >100bp

Nanodrop showed OK results, will run gel tomorrow for extraction

PCR Cleanup of Ligations: 4B4L, PA1L, 4DL, PG01GL, MixL (TS)

Gosset promised to express ship strain VH33deltatyrR (kanamicin 30 ug/ml and chloramphenicol 30 ug/ml) and plasmid pMmelAtyrCpheACM transformed in strain W3110 (tetracicline 30 ug/ml and chloramphenicol 30 ug/ml). Samples are sent in a sterile paper disc that you must place in liquid medium and grow overnight with the required antibiotics.

ELIAS'S LAB NOTEBOOK

PCR cleanup concentrations: ~30ul in each tube

4B4: 105.5ng/ul

PA1: 108.4ng/ul

4D: 44.8ng/ul

P601G: 87.2ng/ul

Mix: 56.8ng/ul

Want >1ng DNA for extraction

ELIM order: mel_meffRedF (forward primer for gibson of repetitive strand directly to pSB1C3)

ELIAS'S LAB NOTEBOOK

Run gel on 4 backbones linearized for only repetitive melanin insert

--> no backbone??

*Only changed gibson tail of forward primer --> worked with previous gibson tail

*mel_meffRedF also matches rAIP plasmid --> will try linearizing this

Uses T7 promoter instead of BBa_J... constitutive promoter in meffRed

ELIAS'S LAB NOTEBOOK

Liquid cultures from Monday both grew (optimization melanin product) --> will cryostock Cm + Kn culture, suspect only the Cm culture of contamination from other cells

Mike got Tc from Stanford --> will dilute and aliquot

Will make new culture of Cm + Tc cells to confirm successful culture was not attributable to contamination

Melanin binding domain:

melmeffRed primer also anneals to Charlie's rAIP plasmid (at RBS) --> will run PCR on this

Linearized backbone will have T7 promoter instead of constitutive

PCR

Run gel on melanin binding backbone

6 PCR tubes + 2 control plasmid + 2 ladder = 10 lanes

PCR products: 1ul prod + 1ul dye + 4ul H2O

Backbone: ~30ng

Lad: 1ul 2-log

Mel binding 3pt gibson:

VH33deltatyrR and pMmelAtyrCpheACM transformed with first PEG transformation protocol (TS, ER)

2x TSS made with LB broth, 10% PEG, 5% DMSO, 50mM Mg2+

31mL LB, 3.15g PEG, 1.6mL DMSO, 0.375g hydrated MgSO4

Cells incubated at 37˚C until they reached an OD of 0.2-0.4 at 600nm, then protocol was followed with TSS

5 plates made with Chl + Tet

PEG transformation failed, new protocol followed from Griffin on a cell culture taken from our cryostock

2 plates made with Chl + Tet

PEG transformation failed again

Decision to wait for second plasmid to come in before starting more PEG transformations

After speaking with Kosuke, it is determined that electroporation is a more reliable method of transforming our cells than a PEG transformation

Liquid cultures grown overnight in preparation

Kosuke's electroporation protocol is followed on 3 liquid cultures of cells

Cells growing black spots in some parts of the pellets -- melanin production?

Cells added to LB, SOC, and SOC

3 Chl + Tet plates made with 1:1 and 1:10 dilutions

Split plate with BH33 and TyrR and pMelA with LC#1 and LC#2, then 1 plate with a 1:1 dilution and 1 plate with a 1:10 dilution

1 colony grew on the 1:1 plate!

4 liquid cultures made:

1 with Tet

1 with Tet, Chl, Kan

1 with Chl, Tet

1 with Chl

PCR:

1:20 dilution of primers

Ran on gel (twice), lanes 1-7 verified for 2250bp linearized plasmid

AroF Site-Directed Mutagenesis (Above 78 C)

AroG_Mut1_Pro150Leu_F: CACCCTACAATATCTCGCTGACCTGATGAGCTGGG (77 C)

AroG_Mut1_Pro150Leu_R: CCAGCGGCAGGTGAGTTTCTCGATATGATCACCCTACAATATC

Reverse Complement: GATATTGTAGGGTGATCATATCGAGAAACTCACCTGCCGCTGG (77 C)

AroG_Mut2_Leu175Asp_F: CCGCGAAGATGCATCAGGGCTTTCTTGTCCGG (81 C)

AroG_Mut2_Leu175Asp_R: CGAATCGCAGGTGCACCGCGAAGATGCATC

Reverse Complement: GATGCATCTTCGCGGTGCACCTGCGATTCG (79 C)

MutMelA Gibson Primers

Gibson 1st Overlap: GAGAAATACTAGATGGCG (56 C)

Gibson MelA F Primer: GAGAAATACTAGATGGCG TGGCTGGTCG (Annealing 69 C, Elongation 72 C)

Gibson Vector R Primer: CTACTAGAGAAAGAG GAGAAATACTAGATGGCG (Annealing 61 C, Elongation 72 C)

Reverse Complement to-order: CGCCATCTAGTATTTCTC CTCTTTCTCTAG

Gibson 2nd Overlap: GTGTCCGCCTAATAC (55 C)

Gibson Vector F Primer: GTGTCCGCCTAATAC TAGTAGCGGCCG (60 C)

Gibson MelA R Primer: GCTAGAAATAGCCATA GTGTCCGCCTAATAC (70 C)

Reverse Complement to-order: GTATTAGGCGGACAC TATGGCTATTTCTAGC (70 C)

Only 1st primer submitted, other 7 will arrive Friday

Miniprepped Colonies 9 and 13-->Added to BioBrick Box for 4D (melanin-binding heptapeptide) and P601 (control peptide) in pSB1C35

Linearized 1pt assembly plasmids from 4D (Colony #9) and P601 (Colony #13)

PCR Cleanup of 4D and P601 products

Gibson assembly of 4D/P601 linearized pSB1C3 backbones with CBD and HisTag

Transformed into NEB 5-alpha

Plated on warmed Cm Plates and stored at room temp over weekend (labeled 4D_3pt and P601_3pt 9/9)

Colonies grew on clean 4D_3pt plate and (potentially contaminated) 4D_3pt plate

No growth on either P601_3pt plates

Put in 37˚C incubator for several hours, as colony growth was small after the weekend at room temp

Colonies picked from each plate and grown up in 5ml LB + 5ul Chl overnight

Miniprep done on both cultures: 51.8ng/ul for the clean 4D_3pt plate

4D_3pt miniprep transformed into T7 (1.45ul 4D_3pt) and grown on Chl plates

4D_3pt T7 transformation grew successfully on plates-->Liquid Culture grown up again overnight

Need to send in plasmid for sequencing

The P601_3pt transformation turned out to be unsuccessful. We will instead use a different sheet (e.g. nylon/cellulose) as a control rather than the binder itself

Site-directed mutagenesis was started for AroG Mut1 and Mut2

DpnI digest and left overnight

MutMelA 2 linearizations begun

Sent in P601_1pt, 4D_1pt, 4D_3pt for VF/VR sequence verification

Started large scale extraction of 4D_3pt protein in T7

PCR cleanup of AroG Mut1 and Mut2 PCR products plus linearized vector and melA for Gibson

Nanodropped concentrations of 4 constructs

Set up 2-piece Gibson Assembly of MelA with Vec

Transformed all 4 into NEB5-alpha

All Transformations were successful

8 colonies picked (3 from AroG_Mut1, 3 from AroG_Mut2, 2 from MutMelA) and grown up overnight plus PCR cleanup and sent in for sequencing

Began Large Scale Extraction for 4D_3pt protein (soluble and insoluble fractions frozen overnight)-->Need to run SDS page gel in morning to find out which it is in]

MutMelA (colony 1), AroG_Mut1 (colony 2, sketchy sequencing but mutation confirmed), and AroG_Mut2 (colony 2, codon fixed) Miniprep liquid cultures

Paste extracted protein on paper after incubating with melanin

Measure UV resistant properties just like Fluorophore assay

4D4 Protein Confirmed on PAGE gel (27.16 kDa) in soluble fraction

Miniprepped and Biobricked AroG_Mut1, AroG_Mut2, MutMelA

SDS Page Gel to confirm melanin binding peptide's presence (Orange Stain):

Lane 1 (far left), lanes 2-3 wash, lanes 4-6 elutions v1, lanes 7-8 wash, lanes 9-11 elutions v2

Prepared 50mL of Phosphate-Buffered Saline

Melanin is insoluble in water, so melanin (125mg) was first dissolved in a polar aprotic solvent (12.5 mL of 100% EtOH) for 10 mg/mL concentration

After heating and shaking, melanin (2 mL) was added to 4 mL PBS and 2mL of purified linker. Done in duplicate with melanin (no linker) as negative control

After 1 hour of shaking incubation at 37 C, 1mL of the bound solution was pipetted onto cellulose sheets (3 patches) and ____ for positive control