Team:SYSU-CHINA/Results/Parts

1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.

Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.

Guo, Z.Y., et al., The elements of human cyclin D1 promoter and regulation involved. Clin Epigenetics, 2011. 2(2): p. 63-76.

Voutev, R. and E.J. Hubbard, A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. Genetics, 2008. 180(1): p. 103-19.

Parts

Abstract for parts

     The genetic circuits of our project Cyclebow included sequences of cyclic promoters, recombinases (and their recognition sites) and fluorescent genes. This summer, we tried hard to standardize most of them into the backbone pSB1C3 so that we can share these useful parts with the whole iGEM community.

     This is the list of our biobricks:

Part Number Details
BBa_K1926001 pCCNE
BBa_K1926002 pKi67(submitted as best part)
BBa_K1926003 pCDK4
BBa_K1926011 loxp-NLS-SNAP-sv40-loxp
BBa_K1926012 vox-NLS-VIKA-sv40-vox(improved part)
BBa_K1926013 vox-DBOX-mCherry-sv40-vox(improved part)
BBa_K1926021 loxp-NLS-SNAP-sv40-loxp-vox-NLS-VIKA-sv40-vox
BBa_K1926022 loxp-NLS-SNAP-sv40-loxp-vox-DBOX-mCherry-sv40-vox
BBa_K1926031 loxp-NLS-SNAP-sv40-loxp-vox-DBOX-mCherry-sv40-vox-CYAN

Cyclic Promoters

BBa_K1926001: A cyclic promoter of Cyclin E from human genome

Description:

This part is a cyclic promoter of protein Cyclin E from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[10,11].

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.

Source:

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
     pCCNE-F: CGTGTTTACATTCCACCCGCGCCA
     pCCNE-R: TGATGGGGCTGCTCCGGCCT
     (Product: 986)

More detail about this part.

BBa_K1926002: A cyclic promoter of Ki67 from human genome

Description:

This part is a cyclic promoter of protein Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[13].

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.

Source:

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
     pKi67-F: ACCTCTGCCCTCCGCCAGCCG
     pKi67-R: ACCCGGTGGCCCTACAGGCTAC
     (Product: 360)

More detail about this part.

BBa_K1926003: A cyclic promoter of CDK4 from human genome

Description:

This part is a cyclic promoter of protein CDK4 from human genome. It can lead to transcription of the downstream DNA sequence in every G1 phase[12].

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.

Source:

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
     pCDK4-F: TGGTGGAGCGAAAAGGTGACAGCATC
     pCDK4-R: GCGGAAACTGGGAGGGCGGGGCGAA
     (Product: 457)

More detail about this part.

System UNITs

BBa_K1926011: The SNAP UNIT: SNAP-tag flanked by loxP

Description:

This part is the SNAP UNIT of cyclebow system including an sv40 nuclear location sequence (NLS), a covalent labeling of fusion proteins named SNAP-tag® and an sv40 terminator flanked by homodromous recognition site of recombinase CRE named loxP. The whole part can be cut off by CRE.

You may use this part to:

1) Localize proteins in vivo with BLOCK and dye from NEB company;
2) Dye after blocking, you are able to see whether an event have an influence on the localization and expression of the interested protein;
3) Fast cut off this part by transient transfecting recombinase gene into nucleus.

Source:

The SNAP-tag® was brought from NEB company. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdna3.1.

More detail about this part.

BBa_K1926012: The VIKA UNIT: recombinase VIKA flanked by Vox

Description:

This part is the VIKA UNIT of cyclebow system including an sv40 nuclear location sequence (NLS), a recombinase gene named VIKA and an sv40 terminator flanked by homodromous recognition site of recombinase VIKA named Vox. The whole part can be cut off by VIKA. This part is the improvement of the BBa_K1641003，which is a plain VIKA.

You may use this part to:

1) Test the cut-off efficiency of recombinase VIKA by qRT-PCR;
2) Fast cut off this part by transient transfecting recombinase gene into nucleus;
3) Do lineage tracking.

Source:

The recombinase gene VIKA and its RTS Vox were got through denovo synthesis. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdn3.1.

More detail about this part.

BBa_K1926013: The mCHERRY UNIT: mCherry flanked by Vox

Description:

This part is the mCHERRY UNIT of cyclebow system including a degradation tag named DBOX, a fluorescent gene mCherry and an sv40 terminator flanked by homodromous recognition site of recombinase VIKA named Vox. The whole part can be cut off by VIKA.

You may use this part to:

1) Provide fluorescent red which can be quickly cut off by transient transfecting recombinase gene into nucleus; 2) Use it as a part of the flp-out system[5].

Source:

The sequence of Vox and DBOX was retrieved from Addgene and got through denovo synthesis. mCHERRY and sv40 terminator were got from commercial plasmid: pentry dcas9 mcherry bira and pentry nls GFP/pcdna3.1, respectfully.

More detail about this part.

BBa_K1926021: The SNAP-VIKA UNIT

Description:

This part is the SNAP-VIKA UNIT of cyclebow including a SNAP UNIT and a VIKA UNIT. The SNAP UNIT, which can be cut off by CRE, includes an sv40 nuclear location sequence (NLS), a covalent labeling of fusion proteins named SNAP-tag® and an sv40 terminator flanked by homodromous recognition site of recombinase CRE named loxP. The VIKA UNIT, which can be cut off by VIKA, includes an sv40 nuclear location sequence (NLS), a recombinase gene named VIKA and an sv40 terminator flanked by homodromous recognition site of recombinase VIKA named Vox.

You may use this part to:

1) Test the cut-off efficiency of recombinase CRE and VIKA by qRT-PCR;
2) Estimate the time needed for genome repair because VIKA can only be expressed after the cut off of SNAP UNIT and genome repair;
3) Fast cut off this part by transient transfecting recombinase gene into nucleus;
4) When there is no CRE, you can use this part as the SNAP UNIT, which can help localize proteins in vivo with BLOCK and dye from NEB company.

Source:

The SNAP-tag® was brought from NEB company. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdna3.1. The recombinase gene VIKA and its RTS Vox were got through denovo synthesis.

More detail about this part.

BBa_K1926022: The SNAP-mCHERRY UNIT

Description:

This part is the SNAP-mCHERRY UNIT of cyclebow including a SNAP UNIT and a mCHERRY UNIT. The SNAP UNIT, which can be cut off by CRE, includes an sv40 nuclear location sequence (NLS), a covalent labeling of fusion proteins named SNAP-tag® and an sv40 terminator flanked by homodromous recognition site of recombinase CRE named loxP. The mCHERRY UNIT, which can be cut off by VIKA, includes a degradation tag named DBOX, a fluorescent gene mCherry and an sv40 terminator flanked by homodromous recognition site of recombinase VIKA named Vox.

You may use this part to:

1) Test the cut-off efficiency of recombinase CRE and VIKA;
2) Estimate the time needed for genome repair because mCherry can only be expressed after the cut off of SNAP UNIT and genome repair;
3) Fast cut off this part by transient transfecting recombinase gene into nucleus;
4) When there is no CRE, you can use this part as the SNAP UNIT, which can help localize proteins in vivo with BLOCK and dye from NEB company.

Source:

The SNAP-tag® was brought from NEB company. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdna3.1. The sequence of Vox and DBOX was retrieved from Addgene and got through denovo synthesis. mCHERRY was got from commercial plasmid: pentry dcas9 mcherry bira.

More detail about this part.

BBa_K1926031: The SNAP-mCHERRY- CYAN UNIT

Description:

This part is the SNAP-mCHERRY-CYAN UNIT of cyclebow including a SNAP UNIT, a mCHERRY UNIT and a plain CYAN. The SNAP UNIT, which can be cut off by CRE, includes an sv40 nuclear location sequence (NLS), a covalent labeling of fusion proteins named SNAP-tag® and an sv40 terminator flanked by homodromous recognition site of recombinase CRE named loxP. The mCHERRY UNIT, which can be cut off by VIKA, includes a degradation tag named DBOX, a fluorescent gene mCherry and an sv40 terminator flanked by homodromous recognition site of recombinase VIKA named Vox.

You may use this part to:

1) Test the cut-off efficiency of recombinase CRE and VIKA;
2) Estimate the time needed for genome repair because mCherry can only be expressed after the cut off of SNAP UNIT and genome repair;
3) Fast cut off this part by transient transfecting recombinase gene into nucleus;
4) When there is no CRE, you can use this part as the SNAP UNIT, which can help localize proteins in vivo with BLOCK and dye from NEB company.

Source:

The SNAP-tag® was brought from NEB company. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdna3.1. The sequence of Vox and DBOX was retrieved from Addgene and got through denovo synthesis. mCHERRY was got from commercial plasmid: pentry dcas9 mcherry bira. CYAN was got from commercial plasmid: puc18 cfp-yfp.

More detail about this part.